ID: 1172162419

View in Genome Browser
Species Human (GRCh38)
Location 20:32877962-32877984
Sequence TTGAATCCTGAGTATGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172162419_1172162424 5 Left 1172162419 20:32877962-32877984 CCCTTCCCATACTCAGGATTCAA 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1172162424 20:32877990-32878012 GGTCTGCTGTCCAAGCGCAGTGG 0: 1
1: 0
2: 1
3: 22
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172162419 Original CRISPR TTGAATCCTGAGTATGGGAA GGG (reversed) Intronic
901463177 1:9403906-9403928 TAAACTCCTGAGTATGGAAATGG + Intergenic
901943726 1:12683998-12684020 TTGATTCCTGTGTGTGGAAAAGG - Intergenic
902890372 1:19438942-19438964 TTAAATCCAGAGCAAGGGAAAGG + Intronic
903253156 1:22071754-22071776 TTGTATCCTAAGTATGAAAATGG + Intronic
906552278 1:46674937-46674959 TTGCATCCAGAGGATGGGAGGGG - Intergenic
907959956 1:59269709-59269731 TTCAATCAAGATTATGGGAAGGG - Intergenic
908411529 1:63870722-63870744 TTCCATCCTCAGTCTGGGAAGGG - Intronic
910792605 1:91066684-91066706 TTGCATCCAGTGTATGAGAAAGG - Intergenic
912185119 1:107266188-107266210 TTGAATAGTGAATATGGGAGGGG + Intronic
915078013 1:153327579-153327601 TTGTATTCTGTGTATAGGAAAGG + Intergenic
915154573 1:153864294-153864316 ATGAATGCTGATTATCGGAATGG + Intronic
916031011 1:160877661-160877683 TTGAATACAGAGGATGGGCAAGG - Intronic
916693779 1:167216966-167216988 CTGTATCCTGAGTATGGTAGTGG - Intergenic
917049823 1:170908438-170908460 TTGAAACCTCAGTATGTGCAAGG - Intergenic
920382610 1:205544097-205544119 CTCACACCTGAGTATGGGAAAGG + Intergenic
921165914 1:212507006-212507028 CTGAATCCTGAGAGTGGGGAAGG - Intergenic
924029111 1:239868785-239868807 ATGAATTCTGAGAATGAGAACGG + Intronic
924354277 1:243153150-243153172 GTGAAGCCTGAATATGGGACTGG + Intronic
1066288230 10:33989320-33989342 TTGAATAGTGACTTTGGGAAAGG - Intergenic
1067926225 10:50511381-50511403 TTGAATACTGAGTCTGAGGATGG - Intronic
1070607619 10:77910054-77910076 TTGAGTGCTGAGTCGGGGAATGG - Intronic
1071552858 10:86580618-86580640 TTGATACCTCAGTAAGGGAAAGG + Intergenic
1073065542 10:100756895-100756917 TTGAGTCCAGAGAAGGGGAAAGG + Intronic
1075609603 10:123841843-123841865 TTGAGGCCTGAGAATGAGAAGGG - Intronic
1076022061 10:127082169-127082191 TTGTTTCCTGAGTAAGGAAATGG - Intronic
1076153236 10:128180927-128180949 TTGAATCCTGATTGTGGGGGTGG - Intergenic
1076562240 10:131374860-131374882 TTGCATCCTGAGGATCGTAAAGG + Intergenic
1076562709 10:131377394-131377416 TTGCATCCTGAGGATTGTAAAGG - Intergenic
1078353961 11:10619444-10619466 TTTTATCCTGGGTATGGGAGGGG + Intronic
1080467485 11:32511393-32511415 TGGAATCCTGAGTGTAGGACGGG - Intergenic
1087042881 11:93819050-93819072 TTGAATCCAGAGTTTTGGGAAGG - Exonic
1087347333 11:96988653-96988675 TTGAATCCAGACCATGGGAATGG + Intergenic
1088965430 11:114716278-114716300 TTGGATCCAGAGTAGGTGAAGGG - Intergenic
1090328542 11:125910174-125910196 GTGAATGTTGAGTATGAGAAGGG - Intronic
1091548230 12:1518698-1518720 TTGGATCCTGGGGCTGGGAACGG - Intergenic
1092487093 12:8912012-8912034 TTTAATCCGGTGTATGGAAATGG - Intergenic
1092993860 12:13929470-13929492 TCCAATCCTGAGTTTGGGAAAGG + Intronic
1093392867 12:18644097-18644119 TCAAAGCCTTAGTATGGGAAGGG - Intronic
1093858620 12:24136087-24136109 TAGGATCCTGAAAATGGGAATGG + Intergenic
1094436633 12:30427721-30427743 TTGACTCCTGGGTCTGGAAACGG + Intergenic
1097474099 12:60032971-60032993 TTGAAAACTTAGTATGTGAAAGG - Intergenic
1098993981 12:77096841-77096863 GTGTATACTGAGTATGTGAAGGG - Intergenic
1099026801 12:77474784-77474806 TTTAATCCTGAGTATGCCTATGG + Intergenic
1099128325 12:78794540-78794562 TTGAATCCTGAGATATGGAAAGG + Intergenic
1099874375 12:88386484-88386506 TTGAATCCTGGGTCTGAAAAGGG - Intergenic
1102989376 12:117303779-117303801 TTGAATCCTGAGTTTGTGCAGGG + Intronic
1103211469 12:119170086-119170108 TTGAATCCTGACTATGGGTCAGG + Intergenic
1104363048 12:128152044-128152066 ATGAAGCCTGAGTCTGGGAGGGG + Intergenic
1106650440 13:31684387-31684409 TTGTAGCCTGAGCATGGGCATGG - Intergenic
1106934095 13:34699190-34699212 TTAAATCCTGGCTATGAGAATGG + Intergenic
1106971026 13:35141658-35141680 TTCTATCCTGAGTATGGGTGTGG + Intronic
1107066277 13:36216962-36216984 TTGAATCTTGTGTAGTGGAAAGG + Intronic
1108116334 13:47132669-47132691 TGGAATCTTGAGTATGAGAGAGG + Intergenic
1108162763 13:47659911-47659933 ATGAATCGGGAGTATGAGAAAGG + Intergenic
1108573725 13:51773526-51773548 TTGAATTCTGAGGGAGGGAAGGG - Intronic
1109824252 13:67697284-67697306 TTGGAGCCTGGGTTTGGGAAAGG - Intergenic
1109828326 13:67753274-67753296 TTGCATGCTGAGCTTGGGAATGG + Intergenic
1111721191 13:91947216-91947238 TTGAATCCTCAGTATGAATAAGG - Intronic
1111925861 13:94462804-94462826 TTGAATCTTGAGTAACTGAAGGG + Intronic
1112745318 13:102521002-102521024 TTGAAGACTGAGTAGGAGAAAGG + Intergenic
1114356246 14:21912373-21912395 TGGAATCCTGATTAGGGAAAAGG + Intergenic
1115575759 14:34709268-34709290 TTTAACCCATAGTATGGGAACGG - Exonic
1118939080 14:70316028-70316050 ATGAAGCCTGAGTGAGGGAAGGG - Intergenic
1120164048 14:81175071-81175093 TTGAGTGCTGGGTATGGGAGAGG - Intergenic
1121516873 14:94558313-94558335 TGGAATCCAGGGAATGGGAAGGG + Intergenic
1123799035 15:23802580-23802602 TTTAATCCTCAGTGTGGGATGGG - Intergenic
1127299684 15:57640660-57640682 GAGAATTGTGAGTATGGGAAGGG + Intronic
1127315235 15:57788613-57788635 TTTAAGCCTACGTATGGGAAAGG + Intergenic
1131103100 15:89709293-89709315 TTGGATCCTGAGGCTGGGCAGGG + Intronic
1131677041 15:94681140-94681162 GTGAAGCATGAGTATAGGAAGGG - Intergenic
1132259059 15:100405729-100405751 GTGTATCCTGATTATGGGGATGG + Intronic
1132311433 15:100860730-100860752 TAGAACCCTGTGGATGGGAAAGG + Intergenic
1133067074 16:3215855-3215877 TTGAGTCCTGAGTATGTGATTGG - Intergenic
1133956029 16:10444614-10444636 TTGAATTCTGAGCAGGGCAATGG + Intronic
1135753453 16:25076095-25076117 TTGACTCCTGAGTCTGAAAAAGG + Intergenic
1136017090 16:27407423-27407445 TTGAAACCTGAGGATGAGAAAGG + Intronic
1136640056 16:31556774-31556796 GTGAATCCCTAGTATGTGAAAGG + Intergenic
1136664707 16:31799760-31799782 GTGAATCCCTAGTATGTGAAAGG - Intergenic
1137647225 16:50086458-50086480 ATGATTCCTGTGTCTGGGAAAGG - Intronic
1138867840 16:60845436-60845458 ATGAATCCAGGGTATGGGAGTGG - Intergenic
1139788135 16:69410663-69410685 TTGAAATCGGAGTGTGGGAAAGG - Intergenic
1142438079 16:90075939-90075961 TCCAATTCTGAGTGTGGGAAGGG + Intronic
1142862483 17:2771255-2771277 TGGGATCCTGAGTCTGGGTAGGG + Intergenic
1143674311 17:8420354-8420376 TTGAATATTTAGTATGGGACAGG - Intronic
1145801411 17:27688326-27688348 CTGGACCGTGAGTATGGGAAGGG - Intergenic
1148686795 17:49505710-49505732 TTGGATCCTGAGGGTGGGGACGG - Intronic
1151170846 17:72244919-72244941 TTGAATCCAGTCTTTGGGAATGG + Intergenic
1153513139 18:5877375-5877397 GTGAATCATAACTATGGGAAAGG - Intergenic
1155896032 18:31327672-31327694 CTGAATTCTGAAAATGGGAAGGG - Intronic
1156999820 18:43510880-43510902 TTGAGTCCTGAGGAAGGAAAAGG + Intergenic
1157372976 18:47134986-47135008 TTGACTCCTTAATAGGGGAATGG - Intronic
1157913593 18:51642173-51642195 TTGAATCTGGAGTATTGGGAGGG - Intergenic
1158444979 18:57511751-57511773 TGGAAACATGAGAATGGGAAGGG + Intergenic
1158867330 18:61650457-61650479 TTGAATCCTAAATAAGGGAGGGG - Intergenic
1160208530 18:76857466-76857488 TGGAATCATAAGAATGGGAAGGG - Intronic
1163975800 19:20850746-20850768 TTGTAGCCTGATAATGGGAATGG + Intronic
1166499641 19:43331219-43331241 TTGAAGCCTGAATAGGGGAGAGG - Intergenic
925240273 2:2319578-2319600 TTGAGTACTGAGTTTTGGAATGG + Intronic
927683907 2:25157921-25157943 TTGATATCTGTGTATGGGAAAGG - Exonic
930924272 2:56797512-56797534 TTAAGACCTGAGTAAGGGAAAGG - Intergenic
932657271 2:73620911-73620933 GGGACTCCTGAGTATGAGAAGGG - Intergenic
938895831 2:135749291-135749313 TTGAATCCTATTTTTGGGAATGG + Intronic
938974108 2:136459069-136459091 TTGCATCCTGAGCCTGGAAAAGG - Intergenic
939411941 2:141838979-141839001 GTGACTCCTGAGTTTGGAAAAGG + Intronic
940105161 2:150091390-150091412 TTTGATACTGACTATGGGAAAGG - Intergenic
940192958 2:151061923-151061945 TTGAATCCACAGTATGGCAAGGG - Intergenic
941733818 2:168949807-168949829 TTGAATCAGCAGTATGGGGAAGG + Intronic
943010672 2:182444259-182444281 TTTAACCCTCAGTATGGGTATGG + Intronic
946579011 2:221106364-221106386 TTGTATACTGAGGATGGGAGTGG + Intergenic
947410681 2:229835763-229835785 TTGAAGCCTGAATGTGGAAATGG - Intronic
948608365 2:239151080-239151102 TTCATCCCTGAGTTTGGGAAGGG - Intronic
1172162419 20:32877962-32877984 TTGAATCCTGAGTATGGGAAGGG - Intronic
1172401353 20:34654380-34654402 TTGAATCCAGGGTGGGGGAAGGG + Intronic
1172845877 20:37929778-37929800 TTGAAGACTGAATGTGGGAAGGG + Intronic
1173277488 20:41597416-41597438 TTGAGTCCTGAGAAAGGAAAGGG - Intronic
1173459947 20:43235105-43235127 TTGAATTCTGAATGTGGAAAAGG + Intergenic
1173951143 20:46994344-46994366 TTGTATCCTGTCTCTGGGAAGGG + Intronic
1174072882 20:47910975-47910997 TTGAGTCCTGAGGAGGGGGAAGG - Intergenic
1174390727 20:50216881-50216903 TAGAACCCTGAGTATTGGAGTGG + Intergenic
1176078316 20:63259263-63259285 GTGGGTCCTGAGTGTGGGAACGG - Intronic
1178466051 21:32848685-32848707 TTTAAATCTGAGGATGGGAATGG - Intergenic
1179447229 21:41440844-41440866 GTGACTCGTGAGTATGGCAAAGG - Intronic
1179936584 21:44609855-44609877 TTGCCTTCTGAGGATGGGAAGGG + Intronic
1181077391 22:20390331-20390353 TAGACTTCTGAGGATGGGAAAGG - Intronic
1181590108 22:23878896-23878918 TTGCATGCTGAGTGTGGGAAGGG - Intronic
1181913756 22:26262548-26262570 AAGAAGCCTGAGAATGGGAATGG - Intronic
1183624651 22:38994197-38994219 CTGAATCCTGAGGAAGAGAAGGG - Intergenic
950128658 3:10527054-10527076 TTGAATCCTGTGTTTGCAAACGG - Intronic
951882910 3:27496929-27496951 CTGAAAGCTGAGAATGGGAAGGG + Intergenic
952162003 3:30703351-30703373 TTGAGTCCTGAGTCTGGGTGGGG - Intergenic
952342494 3:32457853-32457875 CTGAAGCCAGAATATGGGAAGGG - Intronic
952506968 3:34016193-34016215 TTGACTCCTGATTTAGGGAATGG - Intergenic
953802756 3:46039580-46039602 TTGACTCCTGAGTCTGAAAAAGG + Intergenic
953808412 3:46091393-46091415 ATTAATCCTGACTTTGGGAAGGG + Intergenic
953885841 3:46713973-46713995 TTGAATCCTGAGTCAGGCCAGGG - Intronic
955636087 3:61030961-61030983 ATGGATCCTGGGTATGGAAAGGG + Intronic
955920544 3:63950219-63950241 TTGAATCCTTATTATTTGAAAGG + Intronic
957934778 3:86928142-86928164 ATGAATCCTAAGCATGTGAAAGG - Intergenic
958739012 3:98045646-98045668 TTGACCTCTGAGTATGTGAATGG + Intergenic
959312395 3:104755838-104755860 TTTAATCCTGTTTCTGGGAAAGG + Intergenic
962683794 3:137826863-137826885 TGGAATCCTGAGAATTGGAATGG + Intergenic
966319601 3:178686469-178686491 TTTTCTTCTGAGTATGGGAAGGG + Intronic
967566096 3:190974624-190974646 TTGAATCCAGAGTATAGACATGG + Intergenic
968010288 3:195270180-195270202 TTGACTTCTGAGGATGGGACTGG - Intronic
968687671 4:1972460-1972482 TTGAAGCCTTACTGTGGGAAGGG + Intronic
969198644 4:5584047-5584069 TTGAAACCCTAGTATGGGGAGGG - Intronic
974084421 4:57244287-57244309 TTGAATCCACAGGATTGGAAGGG + Intergenic
975975376 4:80089625-80089647 TGGAGCCCTGAGTATGTGAAGGG + Intronic
976129126 4:81865984-81866006 TTGAAACCTGATTTTGGAAAAGG + Intronic
976407587 4:84677670-84677692 TTAAATCCAGTGTATGGGCATGG + Intronic
977673331 4:99720661-99720683 GAGAATCCTTAGTTTGGGAAAGG + Intergenic
978550403 4:109919394-109919416 CTGTATTCTGAGTCTGGGAAGGG + Intronic
978698657 4:111615797-111615819 TGGAATCCTGAGACTGTGAATGG - Intergenic
980775682 4:137432980-137433002 TGGCATTCTGAGAATGGGAATGG + Intergenic
982834844 4:160110556-160110578 TTGAATCCCCAGTATTGGAGGGG - Intergenic
983279486 4:165662226-165662248 TTGAATTCTGAATATGGCACAGG + Intergenic
983320261 4:166188015-166188037 ATAAAACCTCAGTATGGGAAAGG + Intergenic
983523050 4:168730772-168730794 TTGGAGCCTGAGTAAGGGAAGGG + Intronic
985177420 4:187216126-187216148 CTGAATCCTGAGCTGGGGAACGG + Intergenic
986718941 5:10545722-10545744 TTTAATCTTGAGGATGGGAAAGG + Intergenic
990336084 5:54774276-54774298 TTGAAAGCTAAGTTTGGGAAGGG - Intergenic
991307482 5:65194605-65194627 TTGAATTCAGACTATGGAAAAGG - Intronic
992098689 5:73384914-73384936 TTGATTCCTGATTTTGGTAAAGG - Intergenic
993538679 5:89120879-89120901 TTGAATGCTGACTCAGGGAATGG + Intergenic
993545035 5:89201620-89201642 ATGAATCCTAAGCATGGTAAAGG + Intergenic
995061357 5:107814516-107814538 TTGAGTCCTGAGGCTGGGGAGGG + Intergenic
995589512 5:113684892-113684914 TTGAATCCTGAGTATGTTTTTGG - Intergenic
996953739 5:129158958-129158980 TACAATCCTGAACATGGGAATGG - Intergenic
998324447 5:141267267-141267289 TAGTATCCTTAGAATGGGAATGG + Intergenic
998838637 5:146229479-146229501 GTGAATCCAAAGTATGGGGAGGG - Intronic
999773757 5:154794571-154794593 TTGAATCCTTAGTATCGGCCAGG + Intronic
999785028 5:154883139-154883161 TTGAATCCTGAGGGAGGAAAGGG - Intergenic
1005309101 6:24542312-24542334 TTGAAGTATGAGAATGGGAATGG - Intergenic
1007258378 6:40544550-40544572 CTGAATCCAGGGTTTGGGAAGGG - Intronic
1007335072 6:41150008-41150030 TTGAATCCTGAGTATATCAGTGG + Intronic
1010773636 6:79861048-79861070 ATTAATCATGAGTATGGAAAGGG + Intergenic
1011075633 6:83435455-83435477 TTGAATGCTTACTATGGGACAGG - Intergenic
1011212767 6:84971972-84971994 TTGAATCCTTATTATTGGAAGGG - Intergenic
1011512344 6:88114932-88114954 TTGAGTCCTAAGTATGGGTGTGG + Intergenic
1013551635 6:111213273-111213295 TTGATTCCTGAGGAGGTGAATGG + Intronic
1016661276 6:146583639-146583661 GTGAAACCTGCATATGGGAAGGG - Intergenic
1017650194 6:156573894-156573916 TAGATTCCAGAGTCTGGGAAGGG - Intergenic
1018402058 6:163433291-163433313 TTGAAGCCTGAGAAGGGGGAAGG + Intronic
1018924133 6:168194778-168194800 TGGCATCCTCAGGATGGGAAGGG + Intergenic
1019843437 7:3473291-3473313 TTGATTCCCCAGTTTGGGAAAGG - Intronic
1021953391 7:25797683-25797705 TTGAAGACTGAGAATGGGATTGG - Intergenic
1024560728 7:50643129-50643151 TTGAAACCTGTGTATATGAAAGG + Intronic
1027881729 7:83847046-83847068 TTTACTCCTGAGTTTTGGAATGG + Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1029217150 7:98958741-98958763 TTGCATCCTTAAGATGGGAACGG + Intronic
1030623911 7:111822616-111822638 TTGAGTCCTGAGAATGGGAAGGG - Intronic
1032595531 7:133235863-133235885 TTGAAGGCTGAGCATGGGACTGG - Intergenic
1034734572 7:153416552-153416574 CTGGATCCTGAATATTGGAATGG - Intergenic
1035551320 8:529135-529157 TTGAATCCTTGGACTGGGAAAGG - Intronic
1036502989 8:9330475-9330497 TTGAATTCTCAGTATATGAAGGG - Intergenic
1037346230 8:17904239-17904261 TTAAAATCTGAGTGTGGGAATGG + Intronic
1038896427 8:31787897-31787919 TTGAATCCTGACTATGTGTCAGG + Intronic
1039948656 8:42151492-42151514 TTGAAACCTGAAAATGAGAAAGG - Intergenic
1043773074 8:84229039-84229061 CTGGAGCCTGAGTATGGCAATGG - Intronic
1043773318 8:84232918-84232940 TTTTATCTTGAGTATGCGAAAGG - Intronic
1044200824 8:89433565-89433587 TTAAATGCTGAGTTTGAGAAGGG - Intergenic
1045045767 8:98276028-98276050 TTGATTCATGAGAATGGGAAAGG - Intronic
1046391228 8:113575500-113575522 TTGAATCCTGATTTTGGACAGGG + Intergenic
1048961426 8:139582704-139582726 TAGTATCCTGAGAATGGGGAGGG - Intergenic
1049532042 8:143159753-143159775 TTGCATCCTGAGGCTGGGAAAGG - Intronic
1054984641 9:71247426-71247448 TTGCATACTGAGTAAAGGAAAGG + Intronic
1056224801 9:84484295-84484317 TAAAGTCCTGACTATGGGAAAGG - Intergenic
1057269520 9:93642189-93642211 TTGAATTTTGAGGTTGGGAAGGG + Intronic
1060163897 9:121392731-121392753 TTGAATGCTGAGTAGCAGAAGGG - Intergenic
1060410032 9:123394282-123394304 TTTAATCCTGAGCATGGGAGAGG + Intronic
1203349124 Un_KI270442v1:61220-61242 TGGAATCCAGAGGATTGGAATGG + Intergenic
1191786611 X:64923287-64923309 TTGAAGCCTGCCTCTGGGAAAGG + Intronic
1191866987 X:65711899-65711921 TTGAATCTTGAGTACTGGAAAGG + Intronic
1193477949 X:81990187-81990209 TTGAAAACTTAGTGTGGGAAAGG + Intergenic
1196573131 X:117286657-117286679 TTTAGGCCTGAGTAAGGGAAGGG - Intergenic
1197300119 X:124768819-124768841 TTCAATACTGAATATGTGAATGG - Intronic