ID: 1172162685

View in Genome Browser
Species Human (GRCh38)
Location 20:32879404-32879426
Sequence GGTTCAGTGGGCACAGCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172162685_1172162693 -5 Left 1172162685 20:32879404-32879426 CCACCCGCTGTGCCCACTGAACC 0: 1
1: 0
2: 0
3: 15
4: 206
Right 1172162693 20:32879422-32879444 GAACCCTTGCTTTGCAGGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 155
1172162685_1172162696 26 Left 1172162685 20:32879404-32879426 CCACCCGCTGTGCCCACTGAACC 0: 1
1: 0
2: 0
3: 15
4: 206
Right 1172162696 20:32879453-32879475 CTTTTCCCTCTACCCATCTGAGG 0: 1
1: 2
2: 6
3: 41
4: 287
1172162685_1172162690 -10 Left 1172162685 20:32879404-32879426 CCACCCGCTGTGCCCACTGAACC 0: 1
1: 0
2: 0
3: 15
4: 206
Right 1172162690 20:32879417-32879439 CCACTGAACCCTTGCTTTGCAGG 0: 1
1: 0
2: 2
3: 4
4: 132
1172162685_1172162692 -8 Left 1172162685 20:32879404-32879426 CCACCCGCTGTGCCCACTGAACC 0: 1
1: 0
2: 0
3: 15
4: 206
Right 1172162692 20:32879419-32879441 ACTGAACCCTTGCTTTGCAGGGG 0: 1
1: 0
2: 0
3: 9
4: 151
1172162685_1172162691 -9 Left 1172162685 20:32879404-32879426 CCACCCGCTGTGCCCACTGAACC 0: 1
1: 0
2: 0
3: 15
4: 206
Right 1172162691 20:32879418-32879440 CACTGAACCCTTGCTTTGCAGGG 0: 1
1: 0
2: 2
3: 28
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172162685 Original CRISPR GGTTCAGTGGGCACAGCGGG TGG (reversed) Intronic
900414231 1:2527787-2527809 TGTTCAGTGGGCACACAGGTGGG - Intergenic
900870869 1:5301758-5301780 GTTTCTGTGGGCCCAGGGGGAGG - Intergenic
901015285 1:6225840-6225862 GGCAAAGTGGGCACAGCGTGGGG - Intronic
902086816 1:13869012-13869034 GGGTTCGTGGGGACAGCGGGAGG + Intergenic
903215847 1:21842918-21842940 GGAGCTGTGGGCACAGGGGGTGG + Exonic
903681276 1:25098854-25098876 GGTTGAGTGGGCAGAGCGGTTGG + Intergenic
904940721 1:34163868-34163890 GGTGCTGTGGGTAAAGCGGGAGG + Intronic
906362627 1:45176751-45176773 GGTGAAGTGGGCATAGCAGGGGG - Intronic
906553884 1:46691275-46691297 GGTTGACTGGGCTCAGCTGGGGG + Intronic
908152261 1:61314211-61314233 GGCTCTGAGGGCACAGAGGGGGG - Intronic
908267694 1:62395246-62395268 TATTCAGTGGGCACTGCTGGGGG - Intergenic
912044460 1:105437141-105437163 GGTGCAGTGGGCACTGTGGATGG + Intergenic
915115818 1:153598828-153598850 GGGTCAGTGGGCTCAGCCTGTGG - Intergenic
917373213 1:174317961-174317983 GCATCACTGGGCACAGGGGGAGG - Intronic
922379451 1:225007887-225007909 GTTTCAGTAGGCACAGCCTGAGG + Intronic
1063946851 10:11185408-11185430 GGGGCAGTGGGTGCAGCGGGGGG - Intronic
1065228970 10:23577417-23577439 GGTTCAGTGGCCACAGGTTGTGG - Intergenic
1073443171 10:103564771-103564793 GGTCCAGAGGGGACAGCTGGAGG - Intronic
1074916782 10:117964376-117964398 GGTTCAGTGGGCCCAGGGAGAGG + Intergenic
1076693484 10:132235962-132235984 GATACCGAGGGCACAGCGGGAGG + Intronic
1076698683 10:132259040-132259062 GGTACTGGGGGCACAGCTGGGGG + Intronic
1076727915 10:132421909-132421931 GGGTCAGTGTCCACAGCTGGAGG + Intergenic
1076799673 10:132814794-132814816 GGGCTGGTGGGCACAGCGGGAGG - Intronic
1078064682 11:8070656-8070678 GGTTCAGTGGGGACCGAGGAGGG - Intronic
1079256275 11:18834185-18834207 GGTGCAGTGGGCAAAATGGGTGG + Intergenic
1080120062 11:28666862-28666884 GGAGCAGTGAGCACAGCAGGAGG + Intergenic
1081526503 11:43931439-43931461 GGTTCAGTGGGCAGAGGGAGAGG - Intronic
1081690583 11:45075111-45075133 GGCTCAGGGGGGGCAGCGGGAGG + Intergenic
1081767420 11:45621334-45621356 GGTGCTGTGGGCACTGTGGGTGG - Intergenic
1081977269 11:47243618-47243640 GCTTCAGAGTACACAGCGGGTGG + Intronic
1082942842 11:58726406-58726428 GGTTCAAGGGGGACAGGGGGAGG + Intronic
1083749522 11:64753676-64753698 GGCTCTCTGGGCACAGCGGGTGG - Exonic
1084385218 11:68839463-68839485 GTCTCTGTGGGCACGGCGGGTGG - Intronic
1085690585 11:78660692-78660714 CGTTCACTGGGCACAGCATGGGG + Intronic
1088739002 11:112751533-112751555 GCTACAGTGGGCCCTGCGGGAGG + Intergenic
1090870922 11:130746923-130746945 GGTTGCCTGGGCACAGCAGGAGG - Intergenic
1091407746 12:219930-219952 GGGTCAGTGGGCATGGGGGGGGG - Intergenic
1096514516 12:52148612-52148634 GGTGCAGTGGGGTGAGCGGGCGG + Intergenic
1096866408 12:54566246-54566268 GCTTCAGTGGGGACAGAGGCAGG + Intronic
1097451013 12:59736863-59736885 GTTTCAGAGGGCTCAGTGGGAGG - Intronic
1099534298 12:83826409-83826431 GGTACACTGGGCTCAGTGGGGGG - Intergenic
1104969594 12:132525228-132525250 GGTGCTGTGGGCACAGCCAGGGG + Intronic
1104980878 12:132572641-132572663 GGTGGGGCGGGCACAGCGGGTGG + Intronic
1106226846 13:27792637-27792659 GGTGCGGTGGGCGCAGAGGGCGG + Exonic
1109848944 13:68035345-68035367 GGTTAACTTGGCACAGCTGGTGG + Intergenic
1113601179 13:111569255-111569277 GGTTGACTGGGCTCAGTGGGCGG + Intergenic
1114069671 14:19097360-19097382 GGTTCAGTGGGCAAAGAGAGGGG - Intergenic
1114092589 14:19302643-19302665 GGCTCAGTGGGCAAAGAGAGGGG + Intergenic
1116950035 14:50871252-50871274 TGTTCAGAGGGCACAGCAGGGGG - Intronic
1117426341 14:55601977-55601999 CCTTCAGAGGCCACAGCGGGTGG - Intronic
1118151652 14:63196380-63196402 GGTTCAGTGGGCACTACAGGTGG + Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119881576 14:78103959-78103981 GGTTCAGTGGTCAGAGGGGCAGG - Intergenic
1121709165 14:96024574-96024596 GGTTGAGAGGGAACAGAGGGAGG - Intergenic
1122953894 14:105061093-105061115 GAGTCAGTGGGCCCAGCAGGAGG + Intronic
1123028560 14:105439908-105439930 GGATCAGAGGGGGCAGCGGGGGG + Intronic
1124395659 15:29299623-29299645 GGGTCAGTGGGCACAGGATGGGG - Intronic
1125386389 15:39141387-39141409 GGGTGGGTGGGCAGAGCGGGGGG + Intergenic
1126993325 15:54409395-54409417 GGTTCAGTGGGTACATAGGCAGG + Intronic
1128903279 15:71444894-71444916 GGTAGAGTGGGCACAGAGGCAGG - Intronic
1128939546 15:71777310-71777332 GGTGCAGGAGGCACAGCAGGCGG - Exonic
1129243389 15:74265182-74265204 GGTTCAGCGGGCTCAGCCGCTGG - Intronic
1129688320 15:77698796-77698818 GGTCGGGTGGGCACAGCAGGAGG + Intronic
1130956380 15:88630126-88630148 GGTGCAGTGGGAACAGCAGGAGG + Exonic
1130986316 15:88847164-88847186 GGCTCCATGGGCACAGAGGGGGG - Intronic
1131542474 15:93286770-93286792 GGTCCACTGAGCACAGAGGGGGG - Intergenic
1131937702 15:97524789-97524811 GGTGCAGTGGGCTCAGCAGTGGG - Intergenic
1132028432 15:98421534-98421556 GCTTCAGTGGGGGCAGCGTGCGG + Intergenic
1132093688 15:98966322-98966344 ACTTCAGGGGCCACAGCGGGGGG + Intergenic
1132467439 16:83914-83936 GGAGCAGTGGGCACAGCAGGGGG + Intronic
1138619045 16:58197595-58197617 GGATCAGCGGGCCCGGCGGGGGG + Intronic
1142735614 17:1896974-1896996 GTTTCAGTGAGCCCAGCGGGAGG - Intronic
1144762961 17:17717670-17717692 GGTTCAGAGGGCCCAGGTGGGGG - Intronic
1146180255 17:30693704-30693726 GCTTCTGGGGGCACAGCTGGGGG - Intergenic
1146945237 17:36869154-36869176 GGGTCAGAGGTCACAGAGGGAGG + Intergenic
1147148382 17:38499009-38499031 GGCTGGGTGGGCACAGCGGCAGG + Intronic
1147258810 17:39197116-39197138 GCTTCAGTGGGCTGAGCGTGGGG - Intronic
1147554483 17:41467672-41467694 GGTGCAGTGGGCAAAGCCAGTGG - Intergenic
1147557885 17:41491079-41491101 GGATCACTGGGCAGAGCTGGAGG + Intronic
1148213345 17:45821118-45821140 GCTTGAGTGGGCAGAGCCGGGGG + Intronic
1148479915 17:47953292-47953314 GGGTCAGTGGGAAAAGGGGGTGG + Intronic
1148696944 17:49566292-49566314 GGTTCAGAGGCCACAGTGGAGGG + Intergenic
1148804475 17:50257366-50257388 AGTTCAGTGAGAAGAGCGGGAGG + Intergenic
1149557404 17:57584000-57584022 GGTTCAGTGGGTCCAGGGTGGGG + Intronic
1151427653 17:74041488-74041510 GAACCAGTGGGCACAGCTGGTGG + Intergenic
1151497940 17:74470490-74470512 GGTGCAGTGGGCAGAGGTGGTGG + Intronic
1151703496 17:75755283-75755305 GAAGCAGTGGGCACAGCTGGCGG - Intronic
1152390816 17:80002696-80002718 AGTTTGGTGGTCACAGCGGGAGG - Intronic
1152433325 17:80261078-80261100 GGGTCAGTGGGCGCCGCGGGCGG - Intronic
1152798623 17:82320998-82321020 TGTTCTGTGGGCACAGCGCCCGG - Intergenic
1152863450 17:82709199-82709221 GGGTCAGTGGGCAGGGTGGGTGG - Intergenic
1159729944 18:72013577-72013599 GATTCAGTGGGTCCAGCGTGAGG + Intergenic
1160871817 19:1281250-1281272 TGTCCAGTGGGCACACCGAGGGG - Intergenic
1161217990 19:3104323-3104345 GGCTCAGTGGGAGCAGTGGGCGG + Intronic
1161707182 19:5827698-5827720 GGGTCAGTGGGTGCAGGGGGTGG - Intronic
1162332552 19:10039112-10039134 GGTTCTGTGGGGATAGGGGGTGG - Intergenic
1162744757 19:12792129-12792151 GGTGCAGGGGGCGCAGGGGGCGG + Exonic
1163144781 19:15373056-15373078 GGCTCAGAGGACGCAGCGGGGGG + Exonic
1163369535 19:16894191-16894213 GGTGCAGGGGGGACAGCTGGAGG - Intronic
1165266511 19:34666542-34666564 GGCCCAGTGGGCGCAGCAGGTGG - Intronic
1165956479 19:39504627-39504649 GGATCTGCGGGCACAGGGGGTGG + Intronic
1166091586 19:40512827-40512849 GGCGCAGCGGGAACAGCGGGCGG + Exonic
1166774261 19:45302888-45302910 GGATGAGGGGGCTCAGCGGGGGG + Exonic
1167886181 19:52501704-52501726 GGTGCAGTGGGCAGTGGGGGGGG + Intronic
925346946 2:3178362-3178384 GGTTCAGGGCTCACAGCTGGGGG - Intergenic
925922140 2:8645297-8645319 GGGTCAGAGGGCACAGCGATGGG - Intergenic
926718388 2:15941822-15941844 GGAGCAGTGGGCAGAGTGGGGGG + Intronic
927981714 2:27378630-27378652 GGGGCAGTGGGGACAGCGGTAGG + Exonic
929944072 2:46357231-46357253 GGTTCTGTGGGTTCAGTGGGTGG + Intronic
936262461 2:110973649-110973671 AGTTGAGTGGACACAGCTGGAGG + Intronic
936263395 2:110980889-110980911 AGCTCAGTGGGCACAGAGAGGGG - Intronic
937261737 2:120591014-120591036 GCTTTAGTGAGCCCAGCGGGTGG + Intergenic
937320733 2:120959221-120959243 GGTGGAGAAGGCACAGCGGGTGG - Intronic
938113782 2:128589884-128589906 GGGTGAGTGGGCACAGCCTGGGG + Intergenic
938502238 2:131836155-131836177 GGTACAGGGGGCACAGAGGATGG + Intergenic
938930482 2:136082319-136082341 GGTTAAGTGGGCAGTGCTGGTGG + Intergenic
945883485 2:215350712-215350734 ACTACAGTGGGCACAGTGGGAGG + Intergenic
946442095 2:219705097-219705119 GGATCATTGGCCACAGTGGGAGG - Intergenic
947722937 2:232380337-232380359 GGTGCAGGGGGCACAGCAGGGGG + Intronic
948601746 2:239111463-239111485 GCCACAGTGGGCACAGCGCGGGG - Intronic
948709484 2:239817021-239817043 GCATCAGTGGGCACAGAGGCAGG - Intergenic
948723896 2:239920119-239920141 GGTTCAGTGGGGTCACAGGGTGG + Intronic
948911127 2:241003155-241003177 GCTGCAGTGAGCACAGAGGGTGG - Intronic
1168788913 20:562927-562949 GGAACAGTGGGCTCAGCTGGAGG + Intergenic
1169173325 20:3485044-3485066 GGTTGACTGGGCTCAGCTGGTGG + Intronic
1170708025 20:18763543-18763565 GATGCAGTGGGCACTGCCGGTGG + Exonic
1171189681 20:23150370-23150392 GGAGCAGGGGGCACAGCGGAGGG - Intergenic
1171364940 20:24617227-24617249 GGTTCGGTGGGGACGGCTGGAGG - Intronic
1171895335 20:30753131-30753153 GGTTCAGTGGGTACATGTGGAGG - Intergenic
1172066311 20:32223157-32223179 GGTTCACTGGGCCCAGCAGCAGG + Intronic
1172162685 20:32879404-32879426 GGTTCAGTGGGCACAGCGGGTGG - Intronic
1172902728 20:38346697-38346719 GGTACAGTGGGGACAGGGAGTGG + Intronic
1173852309 20:46226925-46226947 AGTGAAGTGGGGACAGCGGGTGG + Intronic
1175918985 20:62441194-62441216 GGGGCTGGGGGCACAGCGGGAGG + Intergenic
1176180256 20:63746565-63746587 GGTCCAGTGGGCACTGGGCGGGG - Exonic
1179805481 21:43834506-43834528 GGTTCTTGGGGCACAGCAGGAGG + Intergenic
1180066095 21:45413251-45413273 AGTTCAGCAGGCACAGCGCGGGG - Intronic
1180488140 22:15819923-15819945 GGCTCAGTGGGCAAAGAGAGGGG - Intergenic
1181566384 22:23741290-23741312 GATGCAGTGGGGACAGCAGGCGG - Intergenic
1184668944 22:46002852-46002874 GGTGGGGTGGGCACAGCGAGAGG + Intergenic
953357190 3:42265526-42265548 GGAACAGTGGGCGCCGCGGGTGG - Intronic
954848429 3:53579732-53579754 GGTGCAGTGGGCAGAGTGTGTGG + Intronic
954940668 3:54369479-54369501 GGTCCAGTGGGGACAGCAGCTGG - Intronic
955272086 3:57510726-57510748 GATTCAGTGGGGACGGGGGGAGG + Intronic
955723762 3:61910742-61910764 GGTTCTGTGGGGAAAGCAGGTGG - Intronic
959252512 3:103966096-103966118 GGTGCTGTGGGCACAGTGGATGG + Intergenic
961457574 3:127031721-127031743 TGCTGATTGGGCACAGCGGGAGG + Intronic
961643404 3:128379291-128379313 GCTTCAATGGCCAAAGCGGGAGG - Intronic
964515120 3:157499470-157499492 GGCTCCGAGGGCACAGCGAGTGG + Intronic
968653854 4:1770390-1770412 GGCTCAATGGGCCCAGCGAGCGG - Intergenic
969101428 4:4771650-4771672 GGGACAGTGGGCAGGGCGGGGGG + Intergenic
969226781 4:5803788-5803810 GGATCAGTGGCCACGGCAGGAGG - Intronic
969533802 4:7743715-7743737 GGTTCAGCGGTCACACCTGGGGG - Intergenic
971384122 4:26127463-26127485 GGGTCTGTGGGCAGAGCTGGAGG + Intergenic
972329104 4:38047322-38047344 GGTTCAGTAGGCAGGGTGGGGGG + Intronic
972364304 4:38359980-38360002 GGTTCAATAGGCACAGAGTGGGG - Intergenic
977923565 4:102672638-102672660 GGATCAGGTGGCACAGCAGGAGG + Intronic
978994018 4:115126722-115126744 GCGTCAGTGGGATCAGCGGGAGG + Intergenic
982017498 4:151169386-151169408 GACTCAGTGAGCACAGCTGGGGG - Intronic
982121538 4:152148036-152148058 GGTTCGGTGGATCCAGCGGGAGG + Intergenic
987051374 5:14149173-14149195 TGTTCTGCGGGCACAGGGGGAGG - Intronic
991642967 5:68772915-68772937 AGGACAGCGGGCACAGCGGGAGG - Intergenic
992049426 5:72929277-72929299 GGTTCAGAGAGGACAGAGGGTGG + Intergenic
996459236 5:123722157-123722179 GGTTCAGTGGGAATGGGGGGAGG + Intergenic
1001481376 5:172091482-172091504 GAGGCAGTGGGCAGAGCGGGAGG - Intronic
1001928630 5:175657667-175657689 GGCTGAGTGGCCACAGCTGGAGG - Intergenic
1002640526 5:180628615-180628637 GGTGTGGTGGGCACAGCGAGGGG - Intronic
1002701965 5:181130723-181130745 GGGCCAGTGGGGACAGCGTGAGG + Intergenic
1002703831 5:181147423-181147445 GGGCCAGTGGGGACAGCGTGAGG - Intergenic
1004119584 6:12807655-12807677 GGTTCATTGGGCAGACTGGGTGG - Intronic
1006438420 6:34039015-34039037 GGTGCAGTGGGCAGAGCACGGGG - Intronic
1007102485 6:39259194-39259216 GGTTGAGGGAGCTCAGCGGGAGG + Intergenic
1009389330 6:63126653-63126675 GGTTCAGGGGGGACAGAGGTGGG + Intergenic
1012602412 6:101114498-101114520 GATCCAGAGGGCACAGTGGGAGG + Intergenic
1014752957 6:125273445-125273467 GGGTCTGTGGGCACACAGGGTGG + Intronic
1015495854 6:133882733-133882755 GGTTCAGTGGGGGCGGTGGGGGG - Intergenic
1019595081 7:1854691-1854713 GGTTCTGTGGGGACAGGGGCAGG - Intronic
1019922354 7:4171150-4171172 GGGTCAGTGGCCACAGGGTGTGG + Intronic
1024064165 7:45718875-45718897 GGCTCAGTGGGCTCAGCAGAAGG + Exonic
1026678731 7:72449485-72449507 GGTAAAGTGGGCACAGAGGGAGG - Intergenic
1029307361 7:99630011-99630033 GGTGCAGTGAGCATAGCAGGTGG + Exonic
1029708064 7:102285979-102286001 GGTGCTGAGGGCACAGCGCGGGG - Intronic
1030073754 7:105719526-105719548 GGTACAGTTAGCACAGCAGGGGG - Intronic
1031630017 7:124033578-124033600 TGTTGAGTGGGCGCACCGGGAGG - Intergenic
1034740710 7:153471049-153471071 GGCTCAGTGGGAACAGTGGAGGG + Intergenic
1034879237 7:154750839-154750861 GGTTCAAGAGGCACAGTGGGAGG + Intronic
1034956219 7:155336992-155337014 GGTTGACTTGGCACAGCAGGAGG - Intergenic
1035458239 7:159023432-159023454 GGGACTGTGGGCACAGCCGGGGG - Intergenic
1038247028 8:25867982-25868004 ATTTCAGTGGGCAGAGGGGGAGG - Intronic
1038614005 8:29076341-29076363 GGTCCACAGGGCACAGCTGGTGG + Intronic
1038871252 8:31496366-31496388 GTCTCAGTGGGCACAGAGTGAGG + Intergenic
1039546650 8:38415543-38415565 GGTGCAGTGGCCAAGGCGGGAGG - Intronic
1040434953 8:47381177-47381199 GGTACAATGGGTACAGAGGGAGG - Intronic
1043485967 8:80699833-80699855 GGTCCAGTGGGCAGAGTGGGTGG - Intronic
1049215670 8:141406822-141406844 CGCTCAGTGGGAACAGCAGGAGG - Intronic
1049423592 8:142527427-142527449 TGTTCACTGGGGACAGCAGGAGG - Intronic
1049465862 8:142751030-142751052 AGGTCAGTGGGCACAGAAGGCGG - Exonic
1049850782 8:144829140-144829162 GGGCCAGTGGGCAGAGCAGGAGG - Intronic
1051535642 9:18154410-18154432 GGTTCCGTAGGCACAGCTAGAGG + Intergenic
1057461702 9:95268892-95268914 GGTTCTGAGAGCACAGCGGCTGG - Intronic
1059458089 9:114412379-114412401 GCCTCAGTGGGTACAGGGGGAGG - Intronic
1059998652 9:119938595-119938617 GGGTCAGTGGGCAGAGCGTTGGG + Intergenic
1060970170 9:127733350-127733372 TTTGCAGTGGGCACAGTGGGGGG - Intronic
1061086801 9:128404418-128404440 GGTGCAGATGGCACAGCTGGTGG + Intergenic
1061407099 9:130398500-130398522 GGTGCAGGGGGCACAGGGGCTGG - Intronic
1061408465 9:130405498-130405520 GGTTCAGTGGACACACCTAGAGG + Intronic
1061729201 9:132600408-132600430 GGTTCTGTGGACACAGAGGCTGG + Intronic
1061929934 9:133827264-133827286 GCCTCAGTGGGCGCAGCGGTAGG - Intronic
1061929976 9:133827456-133827478 GCCTCAGTGGGCGCAGCGGTAGG - Intronic
1061930060 9:133827840-133827862 GCCTCAGTGGGCGCAGCGGTAGG - Intronic
1061930106 9:133828032-133828054 GCCTCAGTGGGCGCAGCGGTAGG - Intronic
1061930128 9:133828128-133828150 GCCTCAGTGGGCGCAGCGGTAGG - Intronic
1062497203 9:136837524-136837546 GGTACAGGGGGCACAGAGGATGG - Exonic
1203562771 Un_KI270744v1:72095-72117 GTTTCAGTGGGCACAGGGTTGGG - Intergenic
1188005400 X:25013135-25013157 GCTGCAGTGGCCACAGAGGGCGG - Exonic
1192853180 X:74979754-74979776 GCTTCTGTGGGCACTGCGGGAGG + Intergenic
1193362452 X:80591947-80591969 GTTTCAGAGGGCACAGCGTTGGG - Intergenic
1195242752 X:102968746-102968768 GGTTCAGCGGGCAGAGCCTGGGG + Intergenic
1195509552 X:105698579-105698601 GGTTTAGTCAGCACAGTGGGTGG - Intronic
1196247788 X:113421073-113421095 GGTTTAGTGGGAATAGGGGGAGG + Intergenic
1201436689 Y:13966440-13966462 GTTACACTGGGCACAGCAGGAGG + Intergenic
1201593431 Y:15639684-15639706 GATTCAGTGGGCACATGTGGAGG + Intergenic