ID: 1172163577

View in Genome Browser
Species Human (GRCh38)
Location 20:32885244-32885266
Sequence CTCCAGAAGTGAGAAGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 313}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172163577_1172163585 21 Left 1172163577 20:32885244-32885266 CCTGCTGCTTCTCACTTCTGGAG 0: 1
1: 0
2: 2
3: 40
4: 313
Right 1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 81
1172163577_1172163581 4 Left 1172163577 20:32885244-32885266 CCTGCTGCTTCTCACTTCTGGAG 0: 1
1: 0
2: 2
3: 40
4: 313
Right 1172163581 20:32885271-32885293 GCCTCATATCAGCTTCTACGTGG 0: 1
1: 0
2: 0
3: 2
4: 41
1172163577_1172163584 6 Left 1172163577 20:32885244-32885266 CCTGCTGCTTCTCACTTCTGGAG 0: 1
1: 0
2: 2
3: 40
4: 313
Right 1172163584 20:32885273-32885295 CTCATATCAGCTTCTACGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 74
1172163577_1172163583 5 Left 1172163577 20:32885244-32885266 CCTGCTGCTTCTCACTTCTGGAG 0: 1
1: 0
2: 2
3: 40
4: 313
Right 1172163583 20:32885272-32885294 CCTCATATCAGCTTCTACGTGGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172163577 Original CRISPR CTCCAGAAGTGAGAAGCAGC AGG (reversed) Intronic
900074449 1:801766-801788 CTCCAGACATGAGGAGCAGGTGG + Intergenic
900868041 1:5282776-5282798 CTACAGAAGGGAGAGGCAGCAGG + Intergenic
900884287 1:5404241-5404263 CTCCAGAGGGGAGAGGAAGCAGG - Intergenic
901057674 1:6456268-6456290 CTCCAGAGGCTGGAAGCAGCAGG + Intronic
901285972 1:8079285-8079307 CACCAGCAATTAGAAGCAGCTGG + Intergenic
901561675 1:10076711-10076733 CTGCAGATGGGAGAAGCAACTGG - Intronic
901771423 1:11532128-11532150 GTCCAGAGGTGACAGGCAGCAGG - Intronic
901846200 1:11984216-11984238 CTCCAGAAGTGACTTGCTGCAGG - Intronic
902247390 1:15129786-15129808 TTCCAGCAGTGAGAGGCTGCCGG - Intergenic
902476679 1:16692187-16692209 CTCCAGAGGCGTGAAGCAGCGGG - Intergenic
902564734 1:17303932-17303954 CTACAGAAGAGTGAAGCACCAGG - Intergenic
903022118 1:20401755-20401777 CTCCAGAAGGAAGCAGCAGTGGG - Intergenic
903313889 1:22485180-22485202 TTCCAGAAGATAGAAGCAGAGGG - Intronic
904212380 1:28894588-28894610 CATCAGAAGAGAGAGGCAGCTGG + Intronic
904429577 1:30453404-30453426 CCCCTGAGGTGAGAAGAAGCTGG + Intergenic
904744736 1:32703514-32703536 CTCCCCAAGAGAGAAGCTGCTGG + Intronic
904854269 1:33485039-33485061 TTCCAGAAGATAGAAGCAGAGGG - Intronic
905288980 1:36908395-36908417 CTCTAGAAGGGAGAGGGAGCAGG - Intronic
905324965 1:37145414-37145436 CTCCAGAAGATGGAGGCAGCAGG - Intergenic
906644448 1:47463738-47463760 CACCAGAAGAGACAAGGAGCTGG - Intergenic
907526830 1:55058611-55058633 CTCCAGGAGTGGGAAGCGGCGGG + Exonic
907571417 1:55487550-55487572 CTCCTGATGTGAGGAGCTGCAGG - Intergenic
908408969 1:63843689-63843711 TTCCAGAAGTGAAAAGGAGAGGG + Intronic
909069970 1:70982294-70982316 TTCCCAAAGTGAGAGGCAGCAGG - Intronic
909756100 1:79227757-79227779 TTCGAGGAGTGAGAAGCAGGGGG - Intergenic
910028193 1:82683389-82683411 CTACAGAGGTGAGATGCAGATGG + Intergenic
910712801 1:90199301-90199323 CTCTAGAAGGCAGCAGCAGCAGG - Intergenic
911414820 1:97557976-97557998 CACCCAAAGTCAGAAGCAGCAGG - Intronic
911661170 1:100503002-100503024 CCCTGGAAGTAAGAAGCAGCAGG + Intronic
912533268 1:110341426-110341448 GTCCAGAATTGAGCAGTAGCCGG + Exonic
915185255 1:154099397-154099419 CTGCAGCAGGGAGATGCAGCTGG - Intronic
917568813 1:176241612-176241634 CTTCCCAAGTGAGAAGCAGCAGG + Intergenic
918412475 1:184273896-184273918 GCCCAGAAGTGAGAAGGAACCGG + Intergenic
920283505 1:204861783-204861805 GTCAAGAAGTGAGAAGAGGCCGG - Intronic
920966736 1:210707303-210707325 CCCCAGCACTGAGAAGCACCAGG + Intronic
922270295 1:224026670-224026692 CTCCAGACATGAGGAGCAGATGG + Intergenic
922493977 1:226041586-226041608 CTGCTGAAGAGAGAGGCAGCAGG + Intergenic
923673208 1:236058893-236058915 CTCCATGGGTGAGAGGCAGCAGG + Intronic
923940272 1:238815988-238816010 CTCCAGAAGACAGAAGCAAAGGG - Intergenic
923944292 1:238865133-238865155 CAGCAGAGGGGAGAAGCAGCTGG - Intergenic
924190952 1:241552304-241552326 CTTAAGAATTGAGAAGTAGCAGG - Intronic
1062935715 10:1385253-1385275 TGCTAGAAGTGAGAAGCAGCAGG + Intronic
1063584119 10:7335441-7335463 CTCCAGAAGCAAGTAGCAGTTGG - Intronic
1064969448 10:21049344-21049366 CTCCAAAAATGCAAAGCAGCGGG - Intronic
1066010382 10:31188818-31188840 TGCCACAAGGGAGAAGCAGCTGG + Intergenic
1066557067 10:36626029-36626051 GTGCAGTAGTGAGAAGGAGCTGG + Intergenic
1067308743 10:45092461-45092483 CTCCAGAAGTAAGCACCAACAGG + Intergenic
1070575084 10:77671542-77671564 CTGCGGAAGTGAGAGGCAGGGGG + Intergenic
1070644361 10:78191259-78191281 CTCCAGATGTGTGCAGCAGGTGG - Intergenic
1070786811 10:79166742-79166764 CTCCTGAAGGGAGAGGAAGCTGG + Intronic
1070812479 10:79305418-79305440 CTCCAGTAGTAACCAGCAGCAGG + Intronic
1071693133 10:87843845-87843867 TTCCAGAAGTGAAAAGGAGATGG - Intergenic
1073567103 10:104544345-104544367 CACCAGAAGTGAGCAGATGCTGG - Intergenic
1075103233 10:119520253-119520275 CTCAGGAAATGAGAAGCAGTCGG + Intronic
1076486964 10:130827984-130828006 CTCCAGAAAATAGAAGCAGAGGG + Intergenic
1076998320 11:310256-310278 CTCCTGCCGTGAGCAGCAGCTGG + Intronic
1077000422 11:319502-319524 CTCCTGCCGTGAGCAGCAGCTGG - Intergenic
1078670373 11:13359370-13359392 CACCAGAAATAAGAAGTAGCTGG + Intronic
1080105877 11:28511749-28511771 CCCAAAGAGTGAGAAGCAGCAGG + Intergenic
1081577898 11:44330632-44330654 CACCAGAAGCTAGAAGGAGCAGG + Intergenic
1081689141 11:45064484-45064506 CTCCACAAGAGAGATGCAGCTGG + Intergenic
1081756177 11:45546311-45546333 CTACAAAAGTGGGGAGCAGCAGG + Intergenic
1081962609 11:47149325-47149347 CTCCAGGTGTCAGAAGCAGCTGG + Intronic
1082768643 11:57188250-57188272 CTTCAGAAGAGAGAGGCAGGAGG + Exonic
1084069696 11:66726473-66726495 GTCCAAAGATGAGAAGCAGCTGG + Intronic
1084722143 11:70913759-70913781 CTCCAGAGACGAGGAGCAGCAGG + Intronic
1085256550 11:75176863-75176885 CTCCGTCAGTGAGATGCAGCAGG - Intronic
1085779233 11:79393512-79393534 CTTCAGAAGTGGGAAACAGCAGG - Intronic
1086753145 11:90525089-90525111 ATGCAGAAGAGAGAAGCAGTTGG + Intergenic
1088618189 11:111654810-111654832 CTCCAAAAGTGTGAAGCTGATGG - Intronic
1089321764 11:117631229-117631251 CACCAGCAGTAAGCAGCAGCAGG - Intronic
1090074894 11:123574109-123574131 CTCCAGCAGGGAGATGCAGAGGG + Intronic
1090108663 11:123880354-123880376 TTCCAGAAGACAGAAGCAGAGGG + Intergenic
1090592783 11:128290611-128290633 CCCCAGAAGTGAGGAGCAACAGG + Intergenic
1090841545 11:130493021-130493043 TTCCAGAAGATAGAAGCAGAGGG - Intergenic
1091197778 11:133746767-133746789 CTTCCCAAGGGAGAAGCAGCAGG + Intergenic
1091357679 11:134950310-134950332 TCCCAGAAGTGAGAGTCAGCTGG + Intergenic
1091666656 12:2423753-2423775 ATCCACAGGTCAGAAGCAGCAGG + Intronic
1091756569 12:3056268-3056290 ATGCAGAAGTGAGAGGCGGCAGG + Intergenic
1093213550 12:16336041-16336063 CTTCAGAATTAAGAAGCAGTAGG + Intergenic
1093767561 12:22982389-22982411 AGCCAGCAGAGAGAAGCAGCTGG + Intergenic
1094256502 12:28434669-28434691 GTCCAGAAGATAGAAGCAGAGGG - Intronic
1094730910 12:33174431-33174453 TTCTAGAAATGAGAAGCAGAGGG - Intergenic
1096101643 12:48973551-48973573 CTTCAGTAGAGAGAAGGAGCAGG - Intergenic
1097008786 12:55938002-55938024 CTCCAGAAGGGAAAAGTAGCAGG - Exonic
1099146956 12:79058637-79058659 GTCGGGAAGTGAGAAGCAGAGGG - Intronic
1101148852 12:101866479-101866501 CTTCAGAAAGGAGAAGCAGCTGG + Intergenic
1101646315 12:106633895-106633917 CTCCAAGAGGCAGAAGCAGCAGG - Intronic
1102003674 12:109574753-109574775 CTCTAGATGTCAGAACCAGCAGG - Intronic
1102200172 12:111052377-111052399 CCCCAGAACTGAGCAGCAGAGGG + Intronic
1102450227 12:113036604-113036626 CCCCTGCAGTGAGAAGCAGCAGG - Intergenic
1104039606 12:125121265-125121287 CACCAGCAGTGAGAGGGAGCGGG + Intronic
1104544247 12:129696896-129696918 CTTCAGAAGATAGAAGCAGCAGG + Intronic
1105243631 13:18628754-18628776 CTCCAGGGGTGAGGAGGAGCTGG + Intergenic
1105892091 13:24689209-24689231 AACCAGCAGTGGGAAGCAGCCGG - Intronic
1107854055 13:44597460-44597482 CAGCAGAAAAGAGAAGCAGCTGG - Intergenic
1108392655 13:49962344-49962366 TTCCAGAAGACAGAAGCAGAGGG + Intergenic
1108440417 13:50447500-50447522 AGCCAGCAGAGAGAAGCAGCTGG - Intronic
1109632595 13:65070964-65070986 TTCCAGAAGACAGAAGCAGAAGG + Intergenic
1112541480 13:100317944-100317966 ATACAGATGGGAGAAGCAGCTGG - Intronic
1113505852 13:110815307-110815329 CTTCAGATGTGAGCAGCAGGAGG - Intergenic
1113927077 13:113947565-113947587 TCACAGATGTGAGAAGCAGCTGG + Intergenic
1118663585 14:68041874-68041896 CAGCAAAAGTGAGAAGCAGATGG - Intronic
1120715550 14:87837363-87837385 GCTCAGAAATGAGAAGCAGCAGG - Intergenic
1120739853 14:88096089-88096111 CTCCAGGAGTGAGAGCCAGAGGG + Intergenic
1121499447 14:94422335-94422357 ATAAAGAAGTGAGATGCAGCTGG - Intergenic
1121732872 14:96198337-96198359 CTCCAGAAGTGAGATGGAGAGGG - Intergenic
1122112957 14:99514590-99514612 CTCCAAAAGCAAGGAGCAGCGGG + Exonic
1122851583 14:104535903-104535925 CTCCAGAAAAGAGAAGCAGAGGG - Intronic
1123780315 15:23620568-23620590 ATCCAGTAGTGAGCAGAAGCCGG - Intronic
1128756113 15:70185185-70185207 CTGCAGAGGTGAGAAGCAGAGGG + Intergenic
1129144421 15:73633780-73633802 GTCCAGAAGGAAGAAACAGCAGG - Intronic
1129738387 15:77978143-77978165 CTCCTGAAGTGAAGATCAGCCGG - Intergenic
1129847686 15:78775466-78775488 CTCCTGAAGTGAAGATCAGCCGG + Intronic
1130088684 15:80800957-80800979 AAACAGAAGGGAGAAGCAGCTGG - Intronic
1130254217 15:82318443-82318465 CTCCTGAAGTGAAGATCAGCCGG - Intergenic
1131324334 15:91428035-91428057 GTCCAGCATTGAGGAGCAGCTGG + Intergenic
1131546936 15:93323469-93323491 CACCAGAAGTGGGAAGAGGCAGG + Intergenic
1133362518 16:5185829-5185851 CCCAAGGAGTGAGCAGCAGCAGG + Intergenic
1133909956 16:10056757-10056779 CACCAGAAGTTAGAAGATGCAGG + Intronic
1135156774 16:20059414-20059436 ACCCAGAGGTGAGAATCAGCTGG - Intronic
1136233400 16:28900834-28900856 CTCCACACGGGCGAAGCAGCAGG - Exonic
1136643392 16:31588047-31588069 CTCCAGCAAGGACAAGCAGCTGG - Intergenic
1138701528 16:58868350-58868372 CTGCATATGTCAGAAGCAGCAGG - Intergenic
1138778267 16:59751916-59751938 CACCTGAAGTGAGAAGAAACTGG + Intronic
1139436646 16:66940422-66940444 CTCCAGTGCTGAGAAGTAGCAGG - Exonic
1139473327 16:67189800-67189822 CTCGGGAAGTGAGAGGGAGCGGG + Intronic
1141093998 16:81149760-81149782 CAGCAGCAGGGAGAAGCAGCAGG + Intergenic
1143095950 17:4478494-4478516 CTCCACAGGTGGGAAGCAACAGG + Intronic
1143113682 17:4568595-4568617 ATCAAGAAGCGAGAAGTAGCGGG - Intergenic
1145723498 17:27094133-27094155 CTCAAGAGATTAGAAGCAGCAGG - Intergenic
1148706642 17:49639806-49639828 ATCTAGAAGGGAGACGCAGCAGG + Intronic
1148852599 17:50562039-50562061 CTCCAGATGTGGGAAGCTTCGGG + Intronic
1149489696 17:57074852-57074874 CTCTTGATGGGAGAAGCAGCAGG - Intergenic
1150641198 17:66950955-66950977 ATCCAGAGGAGAGAAGCAGGTGG + Intergenic
1151218425 17:72593157-72593179 CTCCAGAAGTGGGGCCCAGCTGG - Intergenic
1151550811 17:74821550-74821572 GTCCAGAAGTCAGAGTCAGCAGG + Intronic
1152539261 17:80966784-80966806 CTCCAGAAGTGGGGAGGAGCGGG - Intergenic
1152702251 17:81824931-81824953 CTGCTGCAGTGAGAGGCAGCTGG - Exonic
1152807915 17:82365884-82365906 CTCCAGATATGAGACACAGCTGG - Intergenic
1153630779 18:7067800-7067822 ATACAGAAGGAAGAAGCAGCAGG - Intronic
1153703931 18:7725589-7725611 CAGCAGAGGGGAGAAGCAGCTGG + Intronic
1153780778 18:8493425-8493447 CTCCTCAGGTGAGAAGCAGGAGG - Intergenic
1154228167 18:12527603-12527625 CTCCAGAAGTGGGAACCTGAGGG - Intronic
1154359507 18:13647598-13647620 CTACAGAGGTAAGAAGCAGAAGG - Exonic
1154497227 18:14970844-14970866 TCCCAGAAGTGAGAGTCAGCTGG - Intergenic
1155120866 18:22817024-22817046 CTGCAGCAGGGAGGAGCAGCTGG - Intronic
1155637804 18:27975962-27975984 CGGTAGAAGAGAGAAGCAGCTGG - Intronic
1157161500 18:45318148-45318170 TTCCAGGAGTGGGAGGCAGCTGG + Intronic
1158014402 18:52766675-52766697 CAGCAGAGGGGAGAAGCAGCCGG - Intronic
1159434540 18:68398647-68398669 CTCTGGAGGTGAGAAGCAGTTGG - Intergenic
1159795323 18:72836164-72836186 GCTCAGAGGTGAGAAGCAGCAGG - Intronic
1160373511 18:78393377-78393399 CTACAGATGTGCGAAGAAGCTGG + Intergenic
1160561389 18:79759355-79759377 CTTCAGAAGACAGAAGCAGAGGG - Intergenic
1161052032 19:2169176-2169198 AGCCAGCAGTGAGTAGCAGCCGG + Intronic
1161334949 19:3708105-3708127 CTCCAGATGCAAGAAGCAGGAGG + Intronic
1161836513 19:6650958-6650980 CTCCAGAAGTGAGAAAAGGCAGG + Intergenic
1165720774 19:38078165-38078187 CTACAGAAGAGAGAGGAAGCTGG - Intronic
1166198894 19:41223562-41223584 TTCCAGCAGAGAGAGGCAGCAGG - Intronic
1166571889 19:43802278-43802300 ATCCAGTAGTGAGAAGGGGCAGG - Intronic
1167117563 19:47497109-47497131 CTGCAGAGGAGAGCAGCAGCTGG + Intronic
1167803962 19:51766302-51766324 CTCCAGAAATGACAATCAACAGG - Intronic
1202710700 1_KI270714v1_random:18028-18050 CTCCAGAGGCGTGAAGCAGCGGG - Intergenic
925290291 2:2743554-2743576 CTCCTGAAGGCAGAAGCTGCAGG + Intergenic
925462692 2:4077376-4077398 CTACAGAAGTGAGAAATTGCGGG - Intergenic
927843907 2:26461642-26461664 ATCCAGAACTGAGAAGAGGCAGG - Intronic
928683021 2:33722316-33722338 CTCAAGAACTGAGAGGCTGCAGG - Intergenic
928892908 2:36226010-36226032 TTCCAGAAGATAGAAGCAGAGGG + Intergenic
929457152 2:42074179-42074201 ATCCAGAGGTGAGAAGCAGCAGG + Intergenic
929892204 2:45927657-45927679 CTCCAGAACTGTAAATCAGCAGG + Intronic
930128045 2:47818974-47818996 CTCCAGTACTGAGAAGAAACCGG - Exonic
930527252 2:52545509-52545531 CAGCAGAAGGAAGAAGCAGCTGG + Intergenic
931007411 2:57867652-57867674 CTACAGCAGTGAGAAGCAGTAGG + Intergenic
931271929 2:60711150-60711172 CACCAGAAGCTGGAAGCAGCAGG - Intergenic
932534519 2:72578788-72578810 TTCCAGAAGAATGAAGCAGCAGG + Intronic
934049036 2:88194851-88194873 GTGCAGAGGTGAGAAGCTGCGGG - Intergenic
938646544 2:133336832-133336854 CTCCAAAAGTGACAGGGAGCAGG + Intronic
940971753 2:159903881-159903903 CTTCCGCAGTGAGAGGCAGCAGG + Intronic
942418463 2:175783066-175783088 CCCCAAAACTGGGAAGCAGCAGG + Intergenic
943057476 2:182999992-183000014 CTCCAGAAGTGGGAAGGAGAGGG + Intronic
943415651 2:187599442-187599464 CTCCAGAAGACAGAAGCACATGG + Intergenic
944041316 2:195358104-195358126 CCACAGCAGTGGGAAGCAGCAGG - Intergenic
944308573 2:198206104-198206126 ATACACAAGTGAGAAGCAGGTGG + Intronic
946280387 2:218661946-218661968 TGACAGAGGTGAGAAGCAGCTGG + Exonic
946609266 2:221440317-221440339 CTGCAGAAGAGAGAAGAAACAGG - Intronic
947176946 2:227377258-227377280 CACCAGAAGCCAGGAGCAGCTGG - Intronic
947389842 2:229627868-229627890 CTGCAGTGGTGAGAGGCAGCAGG + Intronic
947711436 2:232318645-232318667 CTCCAGCCGGGAGAAGCAGAGGG - Intronic
947739820 2:232479995-232480017 CTCCTGAAGTGAGGGGCAGCAGG + Exonic
948328872 2:237149771-237149793 CTCCCACAGTGAGGAGCAGCCGG - Intergenic
1168849961 20:969713-969735 CCCCAGCAGTAAGAGGCAGCAGG + Intronic
1170226914 20:14000884-14000906 CCACAGAAGTGAAAAGTAGCCGG - Intronic
1171384885 20:24763425-24763447 CACTTGAAGTGAGAAGCTGCTGG - Intergenic
1172063876 20:32206447-32206469 CCCCAGGAGTGGGAGGCAGCAGG - Intronic
1172163577 20:32885244-32885266 CTCCAGAAGTGAGAAGCAGCAGG - Intronic
1173150794 20:40565260-40565282 CTTCAGAAGGGAGCAGCAGGAGG + Intergenic
1174407522 20:50311820-50311842 CTCCAAAGATGAGAAGCATCTGG - Intergenic
1174916319 20:54657823-54657845 CTCCTGCAGTGAGAGGGAGCAGG - Intergenic
1175102404 20:56588796-56588818 TTCCAGAAGGGAGAGGCAGGAGG - Intergenic
1178086277 21:29114927-29114949 CTCCTGTAGAGAGAAGCATCTGG - Intronic
1179058633 21:37958952-37958974 TTCCAGAAGTGAGAAGCTTCAGG - Intronic
1179163353 21:38915945-38915967 CTTCAGAAGAGAGAACGAGCAGG + Intergenic
1179661507 21:42879007-42879029 CTGCAGAACTGGGAAGAAGCGGG - Intronic
1179709256 21:43203437-43203459 CTTCAGAAGGCAGAAGTAGCAGG - Intergenic
1180007344 21:45028823-45028845 CTCCAGAAGCCAGAAGAGGCAGG - Intergenic
1182125282 22:27811371-27811393 CTCCAGACCTGGGCAGCAGCTGG + Intergenic
1182571677 22:31243905-31243927 CACCAGATGTGATAAGCTGCTGG - Intronic
1183322539 22:37173881-37173903 TCCCAGATGTGAGAGGCAGCTGG - Intronic
1183331026 22:37221588-37221610 ATCCAGAGGCAAGAAGCAGCAGG - Intergenic
1183786110 22:40030074-40030096 CTCCAGATGTAAGGTGCAGCTGG + Exonic
1184081668 22:42225744-42225766 CCCCACAAGTCAGAAGCAGGAGG + Intronic
1184143598 22:42594983-42595005 GTGCAGAAGAGTGAAGCAGCTGG + Intronic
1184413610 22:44339578-44339600 CTCCAGGACTGTGAAACAGCAGG + Intergenic
1184437259 22:44486744-44486766 CACCAGCAGTGATAACCAGCAGG + Intergenic
1184897259 22:47417715-47417737 CTCCAGAAGTTATAAGCTTCTGG + Intergenic
949316050 3:2756784-2756806 CACCAGAAGCTAGAAGAAGCAGG + Intronic
949413045 3:3786532-3786554 CTCCAGAAGTCAAAAGAAGGAGG - Intronic
951544624 3:23811454-23811476 CTCCAGAATTCAGAAGGAGCTGG + Exonic
951711397 3:25587590-25587612 ATACAGATGTTAGAAGCAGCAGG - Intronic
952744356 3:36763821-36763843 CTGCAGAAGGGAGAAGGCGCAGG - Intergenic
956384545 3:68702942-68702964 CTCCAGATTTGGGAAGCACCTGG + Intergenic
956572120 3:70708500-70708522 CTCCACAAGTGGGATGGAGCAGG - Intergenic
956704430 3:71987198-71987220 CACCAGAAGCTGGAAGCAGCAGG + Intergenic
958707371 3:97672936-97672958 CTCCAGTAGTGAGAAGGAAATGG + Intronic
960279578 3:115766252-115766274 GTCCAGAAGTGAAAAGCATGTGG + Intergenic
961150006 3:124629581-124629603 TTCCAAAAGGGAGAAACAGCAGG - Intronic
965223348 3:165955688-165955710 CTCCAGAATTGGGAAACATCTGG - Intergenic
965820551 3:172680398-172680420 GTCCAGAAGTGAGTAGTAGGGGG - Intronic
965890913 3:173512508-173512530 CGGCAGAGGTTAGAAGCAGCTGG - Intronic
966057146 3:175708064-175708086 TTCCAGAAGTGACAAGGAGTTGG + Intronic
966594094 3:181711197-181711219 CTCTAGAGCTGAGAACCAGCAGG - Intergenic
967975748 3:195033977-195033999 CTCCTGAAGTGGGAAGCCGCGGG - Intergenic
968063454 3:195744666-195744688 TTCCAGAAGATAGAAGCAGGAGG - Intergenic
968425254 4:518949-518971 GTCCAGAGGTGAGAAAAAGCCGG - Intronic
969056032 4:4403374-4403396 TTCCAGAAGACAGAAGCGGCAGG - Intronic
970687324 4:18583307-18583329 TTTTAGAAGTGAGAAGCAGAAGG - Intergenic
971272113 4:25159995-25160017 ATCCCGAAGTTAGAAACAGCGGG + Intronic
971498072 4:27288937-27288959 CTACAGAAAAGAGAAGCAGCTGG - Intergenic
971531545 4:27695026-27695048 CTCCAGAAAGGAGAAACAGGAGG - Intergenic
971630565 4:28987878-28987900 CTCAAAGAGTGAGCAGCAGCAGG + Intergenic
972219011 4:36932357-36932379 TTCCAGAAAAGAGAAGCAGAAGG + Intergenic
973879074 4:55250514-55250536 TACCAGAAGTGGGAAGGAGCAGG + Intergenic
974331553 4:60485632-60485654 CTCCTAAAGTGAGAAACAGTGGG - Intergenic
974487003 4:62518318-62518340 CTGGAGAAGTGAGAAGCTGAAGG + Intergenic
976052061 4:81021026-81021048 CCCCAGAAGTTAGAGGCTGCAGG + Intergenic
976385622 4:84454332-84454354 TCCCAGAAGTAAGAAGCTGCTGG + Intergenic
977245954 4:94631561-94631583 GTCCAGAAGTGAGTACTAGCAGG + Intronic
977781482 4:100986193-100986215 CAGCAGAAAGGAGAAGCAGCTGG + Intergenic
977933264 4:102772149-102772171 TTCCAGAAGACAGAAGCAGAGGG + Intergenic
978665799 4:111180384-111180406 TTCCAGAAGACAGAAGCAGAGGG - Intergenic
978882260 4:113719888-113719910 CTACAGAACTGATAAGAAGCTGG + Intronic
979704118 4:123700651-123700673 CCCCAGACATGAGAAGCAGGAGG - Intergenic
979952545 4:126911759-126911781 TTCCAGAAGATAGAAGCAGAGGG + Intergenic
980595175 4:134945991-134946013 TTCCAGAAGATAGAAGCAGAAGG + Intergenic
981038020 4:140192168-140192190 CTCCAGAAGTGATGGGCAACAGG - Intergenic
982873994 4:160621958-160621980 TTCCAGAAGAGAGAAGCATAGGG + Intergenic
984442022 4:179783643-179783665 CTCCAGAAGATAGAAGGAGAAGG - Intergenic
984667107 4:182440755-182440777 CCGCAGAAGTGAGGAGCAGCTGG - Intronic
985641676 5:1066195-1066217 CTCCAAAAGGGAGAATCAGGTGG - Intronic
987446685 5:18028854-18028876 AGCAAGAAGAGAGAAGCAGCCGG - Intergenic
988800837 5:34695221-34695243 CTTCATAACTGAGAAGCTGCAGG + Intronic
989473597 5:41849121-41849143 CTCCAGATGGAAGATGCAGCTGG + Intronic
992083522 5:73257821-73257843 TTCCAGAAGACAGAAGCAGAGGG - Intergenic
993291101 5:86071684-86071706 CTGAAGAAGTGAGGAGGAGCCGG + Intergenic
993803401 5:92374375-92374397 CCCAAAAAGTGAGCAGCAGCAGG + Intergenic
995721564 5:115139911-115139933 TTTCAGAAGTGAAGAGCAGCAGG + Intronic
996098636 5:119425217-119425239 CTCCATGAGTGAGAGGCAGAGGG + Intergenic
996108975 5:119542673-119542695 CTGCAGAGGTGACCAGCAGCAGG + Intronic
996458221 5:123709380-123709402 GTCCAGAAGAGAACAGCAGCTGG - Intergenic
997434133 5:133862023-133862045 CTGTAGAACTGAGAAGCAGGAGG + Intergenic
997680408 5:135746276-135746298 CTCCAGAAGTGCACAGCCGCTGG + Intergenic
997694340 5:135849728-135849750 TTCCAGAAGTGGGGAACAGCAGG + Intronic
999260443 5:150235277-150235299 TTCCAGATGTAAGAAGCACCAGG - Intronic
1002609900 5:180409908-180409930 TTCCAGAAGTTAGAAGCAGAGGG + Intergenic
1004062766 6:12214413-12214435 CTCCAGTATTGAGAGGCTGCTGG + Intergenic
1005032971 6:21528589-21528611 ATCCAGCAGTTAGAAGCTGCAGG + Intergenic
1005843098 6:29757447-29757469 CAGCAGGTGTGAGAAGCAGCAGG - Intergenic
1006175000 6:32116353-32116375 ACCCACAGGTGAGAAGCAGCAGG - Intronic
1007259513 6:40553866-40553888 CCCCAGAGGTGAGAAGCACAAGG - Intronic
1007548362 6:42710426-42710448 CTCCAGAAGTGAGAGACCCCAGG - Intronic
1010584506 6:77641937-77641959 CAGCAGAAGGGAGAAGCATCTGG - Intergenic
1011996446 6:93595041-93595063 CTCCGGATGTGAGAAGCAGTAGG - Intergenic
1012332256 6:98007444-98007466 TTCCAGAAGACAGAAGCAGAGGG - Intergenic
1012731940 6:102894219-102894241 CTACAGAAGTGGGAAGACGCAGG - Intergenic
1013857608 6:114592743-114592765 CTCCAGAAGTGGGCAGCTTCCGG - Intergenic
1015702900 6:136055696-136055718 GTACAAAAGTGAGGAGCAGCTGG + Intronic
1017625297 6:156341637-156341659 CATCAGAAGAGGGAAGCAGCAGG - Intergenic
1018363416 6:163095588-163095610 CTCCGGAAGCTAGAAGCAGCAGG - Intronic
1018396016 6:163378564-163378586 CCCCAGAAGTGAGAAGAGGCAGG + Intergenic
1018501837 6:164419588-164419610 CCCCAGGGGTGAGAAGAAGCAGG - Intergenic
1019227883 6:170530096-170530118 CTTCTGCAGTGAGAAGCTGCTGG - Intergenic
1019834477 7:3368682-3368704 TTCTAGAAGTGAGAAGCATCAGG + Intronic
1021694714 7:23265678-23265700 CTGCAGCAGTGATGAGCAGCAGG + Intronic
1022112449 7:27239818-27239840 CGCGAGAAATGAGAAGCCGCCGG + Intergenic
1023142441 7:37115207-37115229 TTCCAGAAGGTAGAAGCAGAAGG + Intronic
1024062041 7:45705179-45705201 TTCCAGAAGACAGAAGCAGAAGG + Intronic
1024244163 7:47456809-47456831 CTCCAACAGTGAGAACCAGCTGG + Intronic
1024510503 7:50200420-50200442 CTCCATCAGTGAGAAGCATTTGG - Intergenic
1025724519 7:64044767-64044789 CTCCAGGTGTGGGAAGGAGCCGG - Intronic
1026070319 7:67113019-67113041 CTGCAGCTGTGAGATGCAGCAGG - Intronic
1026571517 7:71535359-71535381 ATCCAGAAGGCAGATGCAGCTGG - Intronic
1026789019 7:73319726-73319748 CTCCCGAAGTGAGAGGCACATGG - Intronic
1027862420 7:83601783-83601805 CTCAAGAAGGCAGAAGCATCAGG - Intronic
1029364037 7:100106065-100106087 CATCTGAAGGGAGAAGCAGCAGG - Intronic
1030768537 7:113442685-113442707 CTCCAGAAATGATAAGAAACAGG - Intergenic
1030873073 7:114781655-114781677 CTGCAAAAGTGAAAAGAAGCAGG - Intergenic
1031069906 7:117150587-117150609 CTCCAGCACTGAGAAGCTGCAGG - Intronic
1031970986 7:128064987-128065009 CTACAGAAGTGAAAAGGGGCTGG + Intronic
1033044995 7:137953917-137953939 CTCCAGGAGGGAAAAGCAGCAGG + Intronic
1033598657 7:142873915-142873937 CTCCAGAGGTGAGAAAAATCGGG - Intronic
1035464838 7:159068045-159068067 CTCCAGAAGTGAACAGCAACCGG + Intronic
1035541195 8:439713-439735 CTCCAGACATGAGGAGCAGGTGG - Intronic
1036440892 8:8780946-8780968 CCCCAAGAGTGAGCAGCAGCAGG + Intergenic
1037741397 8:21611927-21611949 TTCTGGAAGTGAGCAGCAGCAGG - Intergenic
1037829187 8:22178025-22178047 CCCCAGAAGTGGGAGGCAGGAGG - Intronic
1038565130 8:28613518-28613540 TTCCAGAAAATAGAAGCAGCGGG - Intronic
1040597692 8:48855795-48855817 TTTCAAAACTGAGAAGCAGCAGG + Intergenic
1040689930 8:49924500-49924522 CTCCAGAAGTGAGCAGAGCCGGG + Intronic
1040907577 8:52485126-52485148 CTCCATGAGTGAGGAGCAGATGG + Intergenic
1041653627 8:60326531-60326553 CTCCAAAAGTGTGAAGGAGAAGG + Intergenic
1043673278 8:82915495-82915517 CTCTAGCATTGAGAAACAGCTGG + Intergenic
1045358893 8:101413912-101413934 CTCTAGAAGTGAGTAGAGGCTGG + Intergenic
1045548383 8:103148695-103148717 CTCCAGAACTGGGAAACAGCAGG + Intronic
1045564124 8:103296502-103296524 TTCCAGAAGATAGAAGCAGGGGG + Intergenic
1047251137 8:123182788-123182810 CTCCAGATGTGGGAAGCAAATGG - Exonic
1048883760 8:138892168-138892190 TTCCAGAAGATAGAAGCAGAGGG - Intronic
1049394970 8:142395748-142395770 TCCCACAAGTGAGCAGCAGCGGG + Intronic
1050329293 9:4529270-4529292 CTGCACAAGTAAGAAGAAGCAGG - Intronic
1050990812 9:12149493-12149515 TTGCAGAGATGAGAAGCAGCTGG - Intergenic
1054962119 9:70980521-70980543 CTCCAGAAGTGAGCAGAAGTAGG - Intronic
1055627384 9:78188033-78188055 AACCAGAAGTGAGAATAAGCAGG + Intergenic
1057596282 9:96418271-96418293 CTGCAGGGGTGGGAAGCAGCGGG + Exonic
1058850987 9:109012696-109012718 GGGCAGAAGTGAGCAGCAGCAGG + Intronic
1060454842 9:123782216-123782238 CTCCAGAAATGATAAGTATCTGG + Intronic
1060611979 9:124975093-124975115 CTCCAGAAATGATAAGAAACAGG + Intronic
1060804670 9:126567197-126567219 TTCCAGAAGTCAGAAGTGGCAGG + Intergenic
1060932660 9:127498509-127498531 CTCAAACAGTGAGAAGCAGCCGG - Intronic
1061076173 9:128342897-128342919 TTCCAAGAGTGAGAAGCAGGAGG - Intronic
1061994455 9:134176682-134176704 CTCTAGAAGCTGGAAGCAGCAGG - Intergenic
1186570558 X:10710856-10710878 TTCCAGATGTGAAAAGCATCTGG - Intronic
1187191145 X:17036574-17036596 CTCCAGAACTGGGAAGCAGCTGG - Intronic
1187410475 X:19046658-19046680 ATCCAGAGGTGAGCAACAGCAGG + Intronic
1187519855 X:20003749-20003771 CTCAGGAAGTGGGGAGCAGCAGG - Intergenic
1189140512 X:38600524-38600546 CTCTGGAAGTGACAAACAGCTGG - Intronic
1190449778 X:50567211-50567233 GCACAGAAGTGAGAAGCAGCAGG + Intergenic
1190652778 X:52583071-52583093 CTCCACTACTGAGACGCAGCCGG + Intergenic
1191730477 X:64329392-64329414 CTTCTGAAGGGAGAAGTAGCTGG - Intronic
1193864035 X:86707439-86707461 TTCCAGAAGATAGAAGCAGAGGG + Intronic
1194000482 X:88422445-88422467 CTCCCCAAGTGGTAAGCAGCTGG + Intergenic
1196407215 X:115376875-115376897 TTCCAGAAGATAGAAGCAGGCGG + Intergenic
1196675910 X:118419907-118419929 GTTCAGAAGTGAGGAGAAGCAGG - Intronic
1197821941 X:130550360-130550382 TTCCAGAAATGAGAAGCACAAGG + Intergenic
1198302733 X:135347224-135347246 TTCCAGTACAGAGAAGCAGCTGG + Exonic
1201242822 Y:11975233-11975255 CTCCATAAGTGAGGGTCAGCAGG + Intergenic
1201790613 Y:17836458-17836480 GCCCAGGAGTGAGAAGCTGCAGG - Intergenic
1201810941 Y:18069531-18069553 GCCCAGGAGTGAGAAGCTGCAGG + Intergenic