ID: 1172163578

View in Genome Browser
Species Human (GRCh38)
Location 20:32885267-32885289
Sequence GTAGAAGCTGATATGAGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172163578_1172163585 -2 Left 1172163578 20:32885267-32885289 CCCCGCCTCATATCAGCTTCTAC 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172163578 Original CRISPR GTAGAAGCTGATATGAGGCG GGG (reversed) Intronic
902963388 1:19980266-19980288 TTAGAAGCTCATATGAGACAGGG - Intronic
904195389 1:28781651-28781673 GTATAAGACGATATGAGGGGTGG + Intergenic
907569119 1:55466822-55466844 GTAGGAGCTGTGATGAGGAGAGG - Intergenic
916659080 1:166904463-166904485 GTAGAAGCTCATATGAAAAGGGG - Intergenic
918263957 1:182822742-182822764 GCAGAAGCTGATATGTTGCACGG + Intronic
918618674 1:186577709-186577731 GTAGAGGCAGATCTGAGGCTTGG + Intergenic
919351211 1:196456145-196456167 GTAGAAGCTGATATTGGAAGTGG + Intronic
919810054 1:201403366-201403388 GAAGAAGCTGAGATCAGGTGAGG + Intergenic
1064139708 10:12780163-12780185 CTAGAAGTTGATGTGGGGCGTGG + Intronic
1065852525 10:29802648-29802670 GTAGGGGCTGATATGGGGTGGGG + Intergenic
1067960104 10:50838663-50838685 GTAGAAGCTGATATAATGATAGG + Intronic
1072686085 10:97537764-97537786 GTAGAAGCAGAAAGGAGGCCTGG + Intronic
1074927294 10:118086195-118086217 GTAGAAGCTGAGCAGATGCGGGG - Intergenic
1075388030 10:122071576-122071598 ATAGAAGCTCGTATGAGGCCAGG + Intronic
1077037095 11:500473-500495 CCAGAAGCTGAGGTGAGGCGGGG - Exonic
1077639788 11:3871160-3871182 GGAGTAGCTGATAGGAGGCCGGG - Intronic
1089523658 11:119082506-119082528 GTAGAAGATGAAATTAGGTGAGG - Intergenic
1090846648 11:130535073-130535095 GTAGAAGCAGATAGAAGGCTGGG + Intergenic
1091354394 11:134924438-134924460 GAAGCAGCTGATCTGAGGCAGGG - Intergenic
1092781867 12:11995037-11995059 GTTAAAGCTGATAAGATGCGTGG - Intergenic
1095363672 12:41375073-41375095 CTAGCAGCTGATAGGAGCCGAGG + Intronic
1095946157 12:47754791-47754813 GAAGCAGCTGATATGAGTCAAGG + Intronic
1096685531 12:53286082-53286104 GTAGAAGGTGCTATGGGGCCAGG - Exonic
1101114558 12:101519369-101519391 GTAGAAGCTTATATTAGTCAGGG - Intergenic
1104958863 12:132478745-132478767 GCAGAAGCCGCTCTGAGGCGGGG + Intergenic
1112089698 13:96069718-96069740 GAAGAATATGATATCAGGCGTGG - Intergenic
1113126369 13:106983865-106983887 GTAGAAGCTGCAATGAGCTGTGG - Intergenic
1115369694 14:32598658-32598680 ATAGAAGCAGATATAAGGAGCGG + Intronic
1124211728 15:27770034-27770056 CTAGAAGCTGAGATGGGGCAGGG + Intronic
1125094515 15:35835614-35835636 GTAGTAGCTTAGATGAGGTGAGG - Intergenic
1130549709 15:84882324-84882346 TGAAAAGCTGATATGAGGCTGGG + Intergenic
1131230885 15:90658468-90658490 GGAGAGGCTGATGTGGGGCGAGG + Intergenic
1131231227 15:90660978-90661000 GGAGAGGCTGATGTGGGGCGAGG - Intergenic
1132652633 16:1028541-1028563 GGACCAGCTCATATGAGGCGAGG + Intergenic
1138181855 16:54945928-54945950 GGAGAAGCTGATATGAACCTAGG - Intergenic
1138287648 16:55822475-55822497 GCAGAAGCTGAGTGGAGGCGTGG + Intronic
1140511918 16:75514830-75514852 GTATAAGCAGATAGGAGGCGTGG - Intergenic
1141952614 16:87348498-87348520 GTAGCAGCTGATCTGGGGCATGG + Intronic
1142981218 17:3673112-3673134 GCAGAAGCTGCAATGAGCCGAGG + Intronic
1147918293 17:43901285-43901307 GAAGAAGCTGCTGTGAGGCGAGG - Intronic
1148462325 17:47845907-47845929 AAAGAAGCTGATATGAGGAAGGG - Exonic
1151935684 17:77259486-77259508 GCAGAAGCTGATGTGAGACGTGG - Intergenic
1154994280 18:21625197-21625219 GAGTAAGATGATATGAGGCGGGG - Intronic
1157544001 18:48535161-48535183 GTGGAAGGTGAGATGAGGCATGG + Intergenic
1157728370 18:49982926-49982948 GCACAAGCTGATATAAGGAGAGG - Intronic
1161044289 19:2126826-2126848 GTGGAAGCAGGTATGAGGAGGGG + Intronic
1162345942 19:10118236-10118258 GTTGAAGCTGAACTGAGGCCTGG - Intronic
1164745416 19:30609147-30609169 CTAGAAGCTGAGATGGGGCAAGG - Intronic
1166441300 19:42817650-42817672 GTAGAAGCTGAGATGATATGAGG - Intronic
1166449480 19:42885962-42885984 GTAGAAGCTGAGATGATATGAGG - Intronic
1166460778 19:42986253-42986275 GTAGAAGCTGAGATGATACGAGG - Intronic
1166478072 19:43146231-43146253 GTAGAAGCTGAGATGATATGAGG - Intronic
931441573 2:62294001-62294023 GGAGGAGCTGGTAGGAGGCGGGG - Intergenic
935065209 2:99641380-99641402 TTAGAAGATGAAATGAGGCCAGG + Intronic
935385929 2:102500271-102500293 GAAGAAGCTCATAAGAGGCAAGG + Intronic
937242712 2:120472777-120472799 GTACAAGCGAATATGAGGGGAGG + Intergenic
1172163578 20:32885267-32885289 GTAGAAGCTGATATGAGGCGGGG - Intronic
1173335390 20:42108622-42108644 GTAGATGCTGGTATTAGGAGTGG + Intronic
1173994425 20:47326903-47326925 GTAGCAGTTGATAAGAGCCGAGG - Intronic
1180971712 22:19819399-19819421 GCAGAAGCTCATCTGAGGAGGGG + Intronic
951120024 3:18915758-18915780 GTAGAAGATAATGTGAGGAGGGG - Intergenic
951596503 3:24324099-24324121 GTTGAAACTGAGATGAAGCGTGG - Intronic
958691019 3:97466354-97466376 GTAAATGCTGATATGGGGCAGGG - Intronic
962305543 3:134282811-134282833 GCAGAAGCTGATAGCAGGCCAGG + Intergenic
971046430 4:22810277-22810299 GTTAAAGCTGATCTGAGGCTAGG - Intergenic
972956807 4:44402723-44402745 GTGCCAGCTGATATGAGGGGAGG - Intronic
985581787 5:700954-700976 GTAAAAGCTAATTTGAGGCACGG + Intergenic
987309980 5:16672798-16672820 GGAGAAGCTGATCCGAGGCCTGG - Exonic
987696382 5:21338918-21338940 GGTGATGCTGATATGAGGCTAGG - Intergenic
988755819 5:34247628-34247650 GGTGACGCTGATATGAGGCTAGG + Intergenic
992025244 5:72663389-72663411 GTAGAAGCTGAGCAGAGGCCTGG - Intergenic
994696070 5:103074674-103074696 GTAGAAGCTGATAAGAATTGGGG - Intergenic
997813812 5:136997184-136997206 GAAGAAGCAGATATGAGGCTGGG - Intronic
998553075 5:143095865-143095887 GAAGAAGAAGATATGAGGCCTGG - Intronic
1000089726 5:157919808-157919830 GCATAAGATGATATGAGGGGTGG + Intergenic
1001766744 5:174254969-174254991 GTATAAATTGATATGAGGCCAGG + Intergenic
1003129076 6:3379677-3379699 GTTCAAGGTGATATGAAGCGAGG - Intronic
1005340167 6:24836295-24836317 GTAGCAGTTGATCTGAGGCCAGG - Intronic
1005554465 6:26959440-26959462 GGTGACGCTGATATGAGGCTAGG + Intergenic
1010799789 6:80162201-80162223 GGAGAAGCTGTTTTGAGGAGGGG - Intronic
1011763016 6:90588518-90588540 GTAGAAGCTGATATAATCAGTGG + Intergenic
1015803759 6:137088250-137088272 GTAGAAACTAACATGAGGCTGGG + Intergenic
1018981453 6:168604875-168604897 TTAGAAGGAGATATGAGGAGGGG + Intronic
1024215740 7:47246589-47246611 GCAGAGGCTGCTGTGAGGCGAGG - Intergenic
1028415662 7:90577973-90577995 GTAGAAGCAGAAATGAGGCTGGG + Intronic
1028693675 7:93683054-93683076 GTAAAAGCTGATGTTAGGTGAGG - Intronic
1030506035 7:110423676-110423698 GTAGAAGGTGATAAGAGTCCTGG + Intergenic
1030595764 7:111537083-111537105 ATAGAAACTGATATGATGCCTGG - Intronic
1030704326 7:112675603-112675625 GTAGAAGCTGAGAAAAGGAGAGG - Intergenic
1033783974 7:144707401-144707423 GTAGAAAATGAGAGGAGGCGGGG - Intronic
1038447414 8:27613510-27613532 GAAGAAGCAGATAGGAGCCGGGG - Intronic
1039703162 8:39981561-39981583 GTGAAAGGTGATCTGAGGCGGGG - Intronic
1043479994 8:80643222-80643244 TTAGAAGCAGAGATGAGGCCAGG + Intronic
1050649345 9:7758259-7758281 CTAGAAGCTGATATGAGACCTGG + Intergenic
1052245604 9:26330233-26330255 GCAGAGGCTTATATGAGGCCAGG - Intergenic
1053150887 9:35741950-35741972 GGAGGAGCTGATTTGAGGAGAGG - Intronic
1055245768 9:74240684-74240706 TTTGAAGCTGAGATGAGGTGGGG + Intergenic
1059686203 9:116639008-116639030 GTAGAAGCAGATGTGAGAGGAGG + Intronic
1186188150 X:7041824-7041846 GTAGAAGCTGAGATGATATGAGG - Intergenic
1187349788 X:18502486-18502508 GTAGGAGATGATATCAGGAGGGG + Intronic
1188522348 X:31052704-31052726 GAAAAAGGTGATATGAGGGGTGG - Intergenic
1191987753 X:67000813-67000835 GTATCAGCTGATATTAGGTGGGG - Intergenic
1201644689 Y:16217413-16217435 GTATAAGCTGAGATGAGGGGTGG + Intergenic
1201658126 Y:16367909-16367931 GTATAAGCTGAGATGAGGGGTGG - Intergenic