ID: 1172163579

View in Genome Browser
Species Human (GRCh38)
Location 20:32885268-32885290
Sequence CGTAGAAGCTGATATGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172163579_1172163589 30 Left 1172163579 20:32885268-32885290 CCCGCCTCATATCAGCTTCTACG 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1172163589 20:32885321-32885343 TGATCCAGTAGAAACCCGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 38
1172163579_1172163585 -3 Left 1172163579 20:32885268-32885290 CCCGCCTCATATCAGCTTCTACG 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172163579 Original CRISPR CGTAGAAGCTGATATGAGGC GGG (reversed) Intronic
900014527 1:138903-138925 TGTAGACGCTGACAGGAGGCAGG + Intergenic
900044392 1:494105-494127 TGTAGACGCTGACAGGAGGCAGG + Intergenic
900065799 1:729011-729033 TGTAGACGCTGACAGGAGGCAGG + Intergenic
902963389 1:19980267-19980289 TTTAGAAGCTCATATGAGACAGG - Intronic
913188236 1:116389730-116389752 CGTGCAAGCTGATCTGAGTCAGG - Intronic
921433715 1:215091914-215091936 GGTAGAAGGTGATGTCAGGCAGG + Intronic
922100923 1:222476360-222476382 TGTAGATGCTGACAGGAGGCAGG + Intergenic
922733695 1:227968312-227968334 TGTAGACGCTGACAGGAGGCAGG - Intergenic
922912721 1:229231082-229231104 GGTAGAAGCAGAAATTAGGCGGG + Intergenic
924148442 1:241101740-241101762 TTTAGAGGCTGATATGAGGCAGG - Intronic
1064353340 10:14596763-14596785 CTTAGAAGGTGAGAGGAGGCAGG - Intronic
1066228168 10:33404879-33404901 AGGAGAAGGTGATATGATGCTGG - Intergenic
1066732479 10:38448583-38448605 TGTAGACGCTGACAGGAGGCAGG - Intergenic
1068196684 10:53726692-53726714 CCTAGATGCTGACATGGGGCTGG - Intergenic
1068484802 10:57644182-57644204 TGTAGAAGCTGATCTCAGGGAGG + Intergenic
1072770154 10:98131354-98131376 CTTTAAAGCTGGTATGAGGCTGG + Intergenic
1075882563 10:125866432-125866454 TGTCGAAGCTGCTATGATGCAGG + Intronic
1076970723 11:130580-130602 TGTAGACGCTGACAGGAGGCAGG + Intergenic
1077639789 11:3871161-3871183 AGGAGTAGCTGATAGGAGGCCGG - Intronic
1081075425 11:38667535-38667557 CCTAGATGCTGCCATGAGGCTGG - Intergenic
1087628417 11:100622750-100622772 CCTAGAAGCTGAGAAGATGCCGG - Intergenic
1090846647 11:130535072-130535094 TGTAGAAGCAGATAGAAGGCTGG + Intergenic
1091354395 11:134924439-134924461 AGAAGCAGCTGATCTGAGGCAGG - Intergenic
1096478751 12:51924212-51924234 CGTCAAAGCTGGTCTGAGGCCGG - Intergenic
1100208879 12:92380626-92380648 GGGAGTAGCTGAGATGAGGCTGG + Intergenic
1101114559 12:101519370-101519392 TGTAGAAGCTTATATTAGTCAGG - Intergenic
1104282439 12:127390262-127390284 GGTAGAATTTGATATTAGGCAGG - Intergenic
1104802293 12:131562251-131562273 AGTTGAAGCTGAGAAGAGGCTGG + Intergenic
1107972505 13:45657212-45657234 TGTTGAGGCTGATATGAGGGAGG + Intergenic
1113720126 13:112549691-112549713 CTTAAAAACTGATAGGAGGCCGG + Intronic
1114758852 14:25289217-25289239 AGTATAACATGATATGAGGCTGG + Intergenic
1119823484 14:77638660-77638682 CCCAGAAGCAGAGATGAGGCTGG - Intergenic
1122233947 14:100321728-100321750 CGTGGTCGCAGATATGAGGCAGG + Intergenic
1124211727 15:27770033-27770055 GCTAGAAGCTGAGATGGGGCAGG + Intronic
1128962017 15:72015982-72016004 CCTTAAAGCTGATCTGAGGCTGG - Intronic
1128983701 15:72204054-72204076 AGTAGAAGCAGATGTGTGGCAGG + Intronic
1129180675 15:73872871-73872893 GGTAGGAGGTGATATGGGGCAGG + Intergenic
1130549708 15:84882323-84882345 ATGAAAAGCTGATATGAGGCTGG + Intergenic
1134473440 16:14549039-14549061 TGTTGAAGCTGAGATAAGGCAGG + Intronic
1135110494 16:19687126-19687148 CCTAGAAGCTGGCATGAAGCAGG + Intronic
1138459023 16:57137183-57137205 CGTAGAAGCGGATGTGGGGCAGG - Exonic
1142175402 16:88642873-88642895 CGTAGAAGCTGGGGTGAAGCTGG - Intergenic
1142297142 16:89231758-89231780 CCCAGAGGCTGATAGGAGGCGGG - Exonic
1142449526 16:90166903-90166925 TGTAGACGCTGACAGGAGGCAGG - Intergenic
1142457565 17:64943-64965 TGTAGACGCTGACAGGAGGCAGG + Intergenic
1143748259 17:9009439-9009461 TGTGGATGCTGATATCAGGCAGG - Intergenic
1148462326 17:47845908-47845930 GAAAGAAGCTGATATGAGGAAGG - Exonic
1151160269 17:72159143-72159165 AGGAGAAGCTTGTATGAGGCAGG - Intergenic
1155963611 18:32016537-32016559 CCTTGAAGCGGATATGGGGCAGG + Intergenic
1163556426 19:17995880-17995902 CGTCAAAACTTATATGAGGCCGG - Intronic
1165672037 19:37687781-37687803 CGTAGGACCTGAAATCAGGCCGG - Intronic
929635175 2:43512254-43512276 CGTAAAAGCTGGTTTGATGCTGG - Intronic
944268921 2:197759792-197759814 CGTAGTAGCTGACATGCTGCCGG + Intronic
1169504724 20:6197066-6197088 CGTAGAAGCTGAAAGTAGGGTGG - Intergenic
1172163579 20:32885268-32885290 CGTAGAAGCTGATATGAGGCGGG - Intronic
1173263423 20:41457045-41457067 CGTAGAAGCAGTTATGAGGTAGG - Intronic
1173809883 20:45949258-45949280 GGGAGAAGCTGATAAGATGCTGG + Intronic
1181562082 22:23711068-23711090 CCTAGAAGATGCAATGAGGCCGG + Intergenic
1183511153 22:38235842-38235864 CGGAGAAGCTGAGACGGGGCTGG + Intronic
1184669961 22:46007283-46007305 CGCAGAAGCTGCTGAGAGGCAGG - Intergenic
952669924 3:35953963-35953985 CCTAGAAGCTGCTATGGGCCAGG + Intergenic
953511411 3:43543681-43543703 CTTAGAAGCAGAATTGAGGCCGG - Intronic
958259584 3:91364717-91364739 ACTAGAAGCTGGTATGAGGGGGG + Intergenic
958691020 3:97466355-97466377 TGTAAATGCTGATATGGGGCAGG - Intronic
962457637 3:135579614-135579636 CGTAGAAGGGGAAATTAGGCCGG + Intergenic
966579313 3:181541894-181541916 AGTAGAATCTGATATGGGTCAGG + Intergenic
968548246 4:1209618-1209640 CCTAGAGGCTGGTATTAGGCTGG - Intergenic
979258869 4:118631211-118631233 TGTAGATGCTGACAGGAGGCAGG - Intergenic
979329481 4:119409346-119409368 TGTAGACGCTGACAGGAGGCAGG + Intergenic
979527844 4:121736268-121736290 CGTAGAAGATGAGATCAGGTTGG - Intergenic
981549064 4:145924542-145924564 CTGAGAAGCTGGTTTGAGGCAGG + Intronic
989377946 5:40785184-40785206 CATTGAAATTGATATGAGGCAGG - Intronic
989535167 5:42555138-42555160 CATAGAAGCTTAAAGGAGGCAGG + Intronic
997813813 5:136997185-136997207 GGAAGAAGCAGATATGAGGCTGG - Intronic
998252364 5:140561727-140561749 GGTAGAAGCTGGTTAGAGGCAGG + Intronic
998665018 5:144287299-144287321 GGGAGAAGCTGGTGTGAGGCGGG + Intronic
1002729451 5:181324824-181324846 TGTAGACGCTGACAGGAGGCAGG - Intergenic
1006726151 6:36200466-36200488 CATAGATGCTGATACGATGCAGG - Exonic
1007633629 6:43285652-43285674 CGGAGAGACTGATGTGAGGCTGG - Exonic
1008972100 6:57380680-57380702 CGAAGAAGCTGGAATGGGGCAGG - Intronic
1008995649 6:57655649-57655671 ACTAGAAGCTGGTATGAGGGGGG - Intergenic
1009161014 6:60282212-60282234 CGAAGAAGCTGGAATGGGGCAGG - Intergenic
1009184177 6:60554418-60554440 ACTAGAAGCTGGTATGAGGGGGG - Intergenic
1010044711 6:71427733-71427755 CCAAGAAGATGATGTGAGGCTGG + Intergenic
1010155582 6:72788434-72788456 TTTAGAAGCTGTTATGAGTCAGG - Intronic
1013260779 6:108439603-108439625 AGTAGAAGGTGATATTAGGGGGG + Intronic
1014859608 6:126448766-126448788 CGTAGAACCTGATTTGAGAGTGG - Intergenic
1014986951 6:128022927-128022949 CCAAGTAGCTGAGATGAGGCAGG - Intronic
1015803758 6:137088249-137088271 TGTAGAAACTAACATGAGGCTGG + Intergenic
1018981452 6:168604874-168604896 CTTAGAAGGAGATATGAGGAGGG + Intronic
1021812159 7:24413386-24413408 TTAAGAACCTGATATGAGGCAGG - Intergenic
1024073777 7:45808261-45808283 TGTAGACGCTGACAGGAGGCAGG - Intergenic
1024649558 7:51391939-51391961 TGTAGATGCTGACAGGAGGCAGG + Intergenic
1025053638 7:55747269-55747291 TGTAGATGCTGACAGGAGGCAGG + Intergenic
1025131741 7:56377743-56377765 TGTAGATGCTGACAGGAGGCAGG + Intergenic
1025182537 7:56830822-56830844 TGTAGACACTGATAGGAGGCAGG + Intergenic
1025912540 7:65840012-65840034 CGTAGAGGCTGACAGAAGGCAGG - Intergenic
1028415661 7:90577972-90577994 GGTAGAAGCAGAAATGAGGCTGG + Intronic
1029008239 7:97232246-97232268 CGTAGACGCTGCTGTGGGGCTGG - Intergenic
1032051173 7:128651945-128651967 TGTAGACGCTGACAGGAGGCAGG - Intergenic
1045093031 8:98766710-98766732 CTTAAAAGCAGAAATGAGGCTGG - Intronic
1047364701 8:124201238-124201260 TGTAGAAGCTGCCATGAGCCAGG + Intergenic
1047487760 8:125347817-125347839 CATAGAATCTGAGATGAGGATGG + Intronic
1059837848 9:118177402-118177424 CCTAGAATGTTATATGAGGCTGG - Intergenic
1203577422 Un_KI270745v1:20093-20115 TGTAGACGCTGACAGGAGGCAGG - Intergenic
1190718654 X:53127915-53127937 CGTGGAAGCTGGCATGATGCTGG + Intergenic