ID: 1172163580

View in Genome Browser
Species Human (GRCh38)
Location 20:32885269-32885291
Sequence ACGTAGAAGCTGATATGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172163580_1172163585 -4 Left 1172163580 20:32885269-32885291 CCGCCTCATATCAGCTTCTACGT 0: 1
1: 0
2: 0
3: 2
4: 98
Right 1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 81
1172163580_1172163589 29 Left 1172163580 20:32885269-32885291 CCGCCTCATATCAGCTTCTACGT 0: 1
1: 0
2: 0
3: 2
4: 98
Right 1172163589 20:32885321-32885343 TGATCCAGTAGAAACCCGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172163580 Original CRISPR ACGTAGAAGCTGATATGAGG CGG (reversed) Intronic
904067572 1:27765845-27765867 AAGTAGAAGAGCATATGAGGTGG + Intergenic
911978545 1:104535054-104535076 ACTCAGAAGCTGGTAAGAGGAGG + Intergenic
922912720 1:229231081-229231103 AGGTAGAAGCAGAAATTAGGCGG + Intergenic
1065852523 10:29802646-29802668 AAGTAGGGGCTGATATGGGGTGG + Intergenic
1068303412 10:55175369-55175391 AGGCAGAACCTGATATTAGGAGG + Intronic
1068610948 10:59059436-59059458 ACCTAGCAGCTGATATGCTGTGG + Intergenic
1075169759 10:120102211-120102233 AGGGAGAAGCTGAATTGAGGAGG + Intergenic
1078177601 11:8981806-8981828 AGGTAGAGGCTGATAGGAAGGGG + Exonic
1078500344 11:11867972-11867994 ACCTTGAAGCTGATGGGAGGAGG - Intronic
1086596594 11:88579464-88579486 AGGTAGAACTGGATATGAGGGGG + Intronic
1094784762 12:33834898-33834920 ATGTGGAAGCTGCTTTGAGGTGG - Intergenic
1096844740 12:54399976-54399998 ACTTAGAAGCTGTAATGAGATGG - Intronic
1097498933 12:60378069-60378091 ATGTGGAAGCTGATAAGACGAGG - Intergenic
1103539620 12:121656884-121656906 ACGTAGAATATGGTATTAGGAGG - Intronic
1109326242 13:60870612-60870634 ACGCAGAAGCTGAGGTGAAGGGG - Intergenic
1111822919 13:93235167-93235189 AGGTTGAAGCTGAAAGGAGGAGG + Intronic
1118072944 14:62265553-62265575 ACGTACAGGATGGTATGAGGGGG + Intergenic
1119854631 14:77890322-77890344 ATGTAGAGGCTGATATGGAGAGG - Intronic
1120953824 14:90064104-90064126 ACGTGGGAGGTGATGTGAGGAGG - Intronic
1127334794 15:57973375-57973397 AAGAAGAAGCTTATTTGAGGTGG - Intronic
1129835756 15:78704418-78704440 ATGTAGAAGGTGCCATGAGGTGG + Intronic
1131442012 15:92466635-92466657 AAATTGAAGCTGATATGAGCTGG + Exonic
1137010080 16:35312830-35312852 AGCTAGAAGCTTATATGAGAGGG + Intergenic
1137966012 16:52934773-52934795 ACGTGGAAGCAGGTGTGAGGGGG + Intergenic
1143370789 17:6437775-6437797 AAGTAGCTGCTTATATGAGGAGG - Intergenic
1146557599 17:33839911-33839933 ACCTAGAAGCTCAGAAGAGGAGG - Intronic
1149519617 17:57308784-57308806 ACGTGGAAGTGGAAATGAGGGGG - Intronic
1155604880 18:27593810-27593832 ACGTAAAAGCTAAAAGGAGGAGG + Intergenic
1157168648 18:45382008-45382030 AGGTAGAAGCTGTTAGGGGGAGG - Intronic
1157539747 18:48492111-48492133 TGGTAAAAGCTGAAATGAGGAGG + Intergenic
1158355051 18:56608698-56608720 ATGCAGAAGCAGATATGAGAAGG + Intronic
1161623104 19:5309637-5309659 ACGGAGAAGATGAGCTGAGGTGG - Intronic
1163408985 19:17141608-17141630 ACAGAGAAGCTGAGAAGAGGTGG - Intronic
1163988982 19:20980824-20980846 AGATAGAAGCTTAGATGAGGAGG - Intergenic
927869200 2:26613093-26613115 AAGCTGAAGCTGAGATGAGGAGG - Intronic
929215991 2:39413920-39413942 ATGTAGATATTGATATGAGGAGG - Intronic
930780325 2:55218620-55218642 AAGTAGAATCTGAGATGAGAAGG + Intronic
930915992 2:56688874-56688896 AAGTATAAGCTGAAAGGAGGAGG + Intergenic
933021658 2:77201970-77201992 ATGTACAAGCTGACAAGAGGTGG + Intronic
934592212 2:95564789-95564811 ACTTAGAAGCTGATTTTGGGTGG - Intergenic
938797494 2:134730684-134730706 ATGTTGAAGCTGATATGATTTGG + Intergenic
941894358 2:170614335-170614357 ACATAGTAGCTGTTATGATGGGG + Intronic
944212987 2:197225795-197225817 ACTTAAAAGGTGATATGGGGTGG + Intronic
1170516180 20:17132817-17132839 ACCAAGAAGGTGATATGAAGTGG - Intergenic
1172163580 20:32885269-32885291 ACGTAGAAGCTGATATGAGGCGG - Intronic
1174172334 20:48625433-48625455 ACCTGGAAGCTAAGATGAGGAGG + Exonic
1180971710 22:19819397-19819419 AGGCAGAAGCTCATCTGAGGAGG + Intronic
1181889348 22:26048027-26048049 ACGTTGAAGCTGAGATGTGAAGG - Intergenic
1182379811 22:29878800-29878822 AAAGAGAAGCAGATATGAGGAGG + Intergenic
949214389 3:1547897-1547919 ACGTAGAACCTGAGTTGAGTGGG + Intergenic
950715514 3:14845007-14845029 AGTTAGAAGCTGAGCTGAGGTGG - Intronic
951120026 3:18915760-18915782 AGGTAGAAGATAATGTGAGGAGG - Intergenic
955874273 3:63473832-63473854 AGCTAGAAGCTGAGATCAGGTGG + Intronic
956529350 3:70200666-70200688 ACGTAGATTCTAATAGGAGGAGG - Intergenic
958259583 3:91364716-91364738 GACTAGAAGCTGGTATGAGGGGG + Intergenic
960921476 3:122751220-122751242 AAGTAGAAATTGCTATGAGGAGG - Intronic
964626994 3:158769164-158769186 AAGTAGATGCAGATATGCGGGGG - Intronic
966960153 3:184927503-184927525 ACTAAGCAGCTGAAATGAGGGGG - Intronic
967473866 3:189892974-189892996 AGGAAGAAGCTGAGGTGAGGAGG - Intronic
970565383 4:17327159-17327181 AAGGAGAAGCAGAGATGAGGTGG - Intergenic
972273903 4:37539202-37539224 AAGTAGAAGCTGTTAAAAGGAGG + Intronic
972276353 4:37561398-37561420 AAGTGAAAGGTGATATGAGGTGG + Intronic
974231257 4:59117490-59117512 TCATAAAAGGTGATATGAGGGGG + Intergenic
974452581 4:62085612-62085634 TACTAGAAGCTGGTATGAGGGGG + Intergenic
976621798 4:87135885-87135907 ATGCAGAAGCAGAGATGAGGAGG + Exonic
980969036 4:139552226-139552248 AAGTAGAATCTGATATTAGGGGG + Intronic
981860210 4:149346043-149346065 AAGTAAAAGCTGAGATGAAGAGG - Intergenic
983670101 4:170226846-170226868 ATGTAGAAGCTAAGATGAGTAGG + Intergenic
983677599 4:170314118-170314140 ATGTAGAAGATGGTAAGAGGTGG + Intergenic
986470329 5:8067408-8067430 ACTTAGAGGCTGAGATGAGAAGG + Intergenic
986488893 5:8269363-8269385 TCTTAGAAGCTGATATGTTGGGG + Intergenic
988383514 5:30530943-30530965 ACATAGAAGTTGATAAGAGATGG - Intergenic
991676457 5:69093857-69093879 CCGGAGAGGCTGATAGGAGGCGG + Exonic
993894881 5:93522523-93522545 ACATAGAATGTGAAATGAGGTGG + Intergenic
995523926 5:113035672-113035694 ACACTGAAGCTGAGATGAGGAGG - Intronic
1000817347 5:165940060-165940082 AGGTAGAAACTGAGATGACGGGG - Intergenic
1005719954 6:28591244-28591266 AAGGAGCAGCTGCTATGAGGAGG + Intronic
1007729526 6:43937473-43937495 ACGGACAAGCTAAAATGAGGTGG + Intergenic
1008995650 6:57655650-57655672 GACTAGAAGCTGGTATGAGGGGG - Intergenic
1009184178 6:60554419-60554441 GACTAGAAGCTGGTATGAGGGGG - Intergenic
1009350290 6:62667190-62667212 ACTCAGAAGCCAATATGAGGAGG + Intergenic
1013260778 6:108439602-108439624 GAGTAGAAGGTGATATTAGGGGG + Intronic
1014259336 6:119197947-119197969 ATTTAGAAGCTGCTATGAAGGGG - Intronic
1015095848 6:129415150-129415172 AGGTAGAAGCTGAGAGGACGAGG - Intronic
1018981451 6:168604873-168604895 ACTTAGAAGGAGATATGAGGAGG + Intronic
1022818100 7:33932681-33932703 ACGCAGCAGCTAATATGATGAGG - Intronic
1030395651 7:108982675-108982697 ACATAGAATCTTATAAGAGGAGG - Intergenic
1035219562 7:157397786-157397808 ACATAGAAGCTGAATTGAGAAGG - Intronic
1036505332 8:9349661-9349683 ACTGAGCATCTGATATGAGGTGG - Intergenic
1038919880 8:32070931-32070953 ACGGTGAAGCTGAGGTGAGGTGG - Intronic
1046414390 8:113892596-113892618 AAGTAGAAGCTAAGAGGAGGTGG - Intergenic
1048786450 8:138055669-138055691 TTGTAGAAGCTGAAAGGAGGAGG - Intergenic
1049630670 8:143654185-143654207 ACCCATAAGATGATATGAGGTGG - Exonic
1050375740 9:4970955-4970977 ACAAGGAAGGTGATATGAGGTGG - Intergenic
1050542328 9:6681191-6681213 ACGGAGAAACTGATCTGGGGCGG + Intergenic
1059587926 9:115626378-115626400 CCGTAGAAGCTGGTAAGGGGTGG + Intergenic
1059709990 9:116858826-116858848 AGGTAAAAGATCATATGAGGAGG - Intronic
1061631062 9:131872484-131872506 ACGTAGAAGCCGATATTGGCTGG - Intronic
1193578418 X:83232001-83232023 ACATAGATGCTGAAATGATGTGG - Intergenic
1195229291 X:102829953-102829975 ACGTAGCAGATCAAATGAGGGGG - Intergenic
1201619309 Y:15937888-15937910 ACTTAGAAACTGATTAGAGGAGG + Intergenic