ID: 1172163582

View in Genome Browser
Species Human (GRCh38)
Location 20:32885272-32885294
Sequence CCCACGTAGAAGCTGATATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172163582_1172163585 -7 Left 1172163582 20:32885272-32885294 CCTCATATCAGCTTCTACGTGGG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 81
1172163582_1172163589 26 Left 1172163582 20:32885272-32885294 CCTCATATCAGCTTCTACGTGGG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1172163589 20:32885321-32885343 TGATCCAGTAGAAACCCGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172163582 Original CRISPR CCCACGTAGAAGCTGATATG AGG (reversed) Intronic
901176713 1:7306786-7306808 CCAACGTAGAATCTGAGATATGG - Intronic
902132471 1:14274694-14274716 CCCACGTCACAGCTAATATGTGG - Intergenic
902216699 1:14938710-14938732 CCCACTTAGAAGGGGATATCTGG + Intronic
905767099 1:40610306-40610328 CCCACCTGGAAGCTGCCATGGGG + Intergenic
905953179 1:41970452-41970474 CCCACTTATAAGATAATATGTGG - Intronic
915940944 1:160117804-160117826 ACCACGGAGAGGCTGAGATGGGG + Intronic
916064205 1:161123074-161123096 CCCAAGGAGAAGCAGACATGTGG - Exonic
917287893 1:173440728-173440750 TCTACGTAGGAGCTGGTATGAGG - Intergenic
921725212 1:218515770-218515792 CCCACTTAAAAGCAGATATAGGG + Intergenic
1068142741 10:53027529-53027551 CCCAAGCAGCAGCTGATATTAGG - Intergenic
1076505394 10:130969696-130969718 CCCACTTACCAGTTGATATGTGG - Intergenic
1077232592 11:1464733-1464755 CCCACCTTGAAGCTGGCATGCGG - Intergenic
1079101823 11:17546845-17546867 CCCAGGTGGAAGCTGAGGTGGGG + Intergenic
1085124030 11:73985736-73985758 CCCACTTAGCAGATGAGATGGGG + Intergenic
1085699517 11:78733708-78733730 CCCACATGGAACCTGATTTGAGG + Intronic
1104466173 12:128992911-128992933 CCCACGGAGACGCTGCTTTGAGG - Intergenic
1108098814 13:46933655-46933677 ATCTGGTAGAAGCTGATATGAGG + Intergenic
1108417953 13:50219947-50219969 CCCATGTTGTAGCAGATATGAGG - Intronic
1109393812 13:61727044-61727066 GCTCAGTAGAAGCTGATATGTGG + Intergenic
1117895756 14:60485341-60485363 CCCACGCATAAGCGGTTATGCGG - Intronic
1122872365 14:104645254-104645276 CCCACGTCTAAGCTGACAAGAGG - Intergenic
1130133838 15:81165167-81165189 CCCACCTGGATGCTGCTATGGGG + Intronic
1133705632 16:8352130-8352152 CCCACGAAGAAACACATATGAGG + Intergenic
1135255159 16:20935861-20935883 CCCAGGTGCAAGCTGATATCAGG + Intronic
1139184898 16:64794375-64794397 CCCATGAAGAAGCTGATTGGGGG - Intergenic
1142416652 16:89946899-89946921 CCCAGGTGGGAGCTGAGATGGGG + Intergenic
1147515583 17:41114580-41114602 CCCACCTAGATGCTGCTGTGGGG + Intergenic
1149052238 17:52319452-52319474 CCCACTTAGAAACAGAAATGAGG - Intergenic
1152672391 17:81616835-81616857 CCCATGTAGAGGTTGATATTCGG - Intronic
1157168650 18:45382011-45382033 GCCAGGTAGAAGCTGTTAGGGGG - Intronic
933625319 2:84591046-84591068 TCCAGGTAGAAGCTGAGATTTGG - Intronic
941141045 2:161782137-161782159 CCCAGGGAGAAGCTGAAAGGTGG - Intronic
945295178 2:208163430-208163452 TCCTCGTAGAAGGTGATCTGAGG + Exonic
947359317 2:229331787-229331809 CCCACGGAGAAGGTAGTATGGGG - Intergenic
947804048 2:232952579-232952601 TCCATGTAGAAATTGATATGTGG - Intronic
1172163582 20:32885272-32885294 CCCACGTAGAAGCTGATATGAGG - Intronic
1175325575 20:58125499-58125521 ACCAGGTAGTAGCTGTTATGTGG + Intergenic
950997516 3:17518819-17518841 CCCACCTAGACACTGCTATGGGG + Intronic
952387849 3:32855740-32855762 CCCCAGTATAAGCTGACATGTGG + Intronic
955596346 3:60594765-60594787 CCCAGGGAGAACCAGATATGGGG - Intronic
962292623 3:134149229-134149251 CCCTCCCAGAAGCTGAGATGTGG + Intronic
964468879 3:157030349-157030371 CCCAGATAGATGCTGTTATGGGG - Intronic
978398888 4:108310679-108310701 CCCCCCTAGAAGCTGCTGTGGGG + Intergenic
980233524 4:130074303-130074325 CACTGGTGGAAGCTGATATGAGG - Intergenic
980477943 4:133344632-133344654 CCCAGGTAGAAACTGATATCTGG + Intergenic
980681690 4:136170694-136170716 CCAATGTAGAAGCTGTGATGTGG - Intergenic
983138067 4:164110006-164110028 CACACTTAGGAGCTGATATATGG + Intronic
990601976 5:57368044-57368066 TCCAAGAAGAAGCTAATATGTGG - Intergenic
993510643 5:88767613-88767635 CCCCAGTAGAAGTTGATATCTGG - Intronic
1000837123 5:166169068-166169090 CACATCTAGAAGATGATATGAGG - Intergenic
1012120705 6:95363186-95363208 CCCACGTATAAGCTTATAAGTGG - Intergenic
1018110392 6:160531678-160531700 CCTACTTAGAAGCTGAAACGTGG - Exonic
1029362080 7:100095238-100095260 TCCACTTAAAAGCTGATCTGAGG + Intronic
1054639137 9:67523499-67523521 CCCAGGCAGAAGCTGGTAGGAGG - Intergenic
1057557037 9:96096236-96096258 CTCACATAGAAGCTGCTGTGTGG + Intergenic
1187210456 X:17225843-17225865 TCCATGTAGAAGCTGGGATGTGG + Intergenic
1187458233 X:19461688-19461710 CCCATTAAGAAGCTGAAATGGGG + Intronic
1202334306 Y:23790668-23790690 CCCACTTAGAAACTCATTTGAGG + Intergenic
1202536462 Y:25879391-25879413 CCCACTTAGAAACTCATTTGAGG - Intergenic