ID: 1172163585

View in Genome Browser
Species Human (GRCh38)
Location 20:32885288-32885310
Sequence ACGTGGGGCCCTTTTTCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172163582_1172163585 -7 Left 1172163582 20:32885272-32885294 CCTCATATCAGCTTCTACGTGGG 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 81
1172163578_1172163585 -2 Left 1172163578 20:32885267-32885289 CCCCGCCTCATATCAGCTTCTAC 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 81
1172163579_1172163585 -3 Left 1172163579 20:32885268-32885290 CCCGCCTCATATCAGCTTCTACG 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 81
1172163580_1172163585 -4 Left 1172163580 20:32885269-32885291 CCGCCTCATATCAGCTTCTACGT 0: 1
1: 0
2: 0
3: 2
4: 98
Right 1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 81
1172163577_1172163585 21 Left 1172163577 20:32885244-32885266 CCTGCTGCTTCTCACTTCTGGAG 0: 1
1: 0
2: 2
3: 40
4: 313
Right 1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG 0: 1
1: 0
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172163585 Original CRISPR ACGTGGGGCCCTTTTTCTTT TGG Intronic
914986163 1:152458970-152458992 AAGCGGGGCCCTGTGTCTTTGGG - Intergenic
915121801 1:153634064-153634086 ACGTGGCGGCCATTTTGTTTTGG + Exonic
921348224 1:214208886-214208908 ACTTGGGTGCCTTTGTCTTTTGG + Intergenic
1072551957 10:96485883-96485905 ACATCGGACACTTTTTCTTTGGG - Intronic
1075934273 10:126326379-126326401 ACAGGGGGTCCTTTCTCTTTGGG + Intronic
1079080350 11:17409532-17409554 TCTTTGGGCCTTTTTTCTTTGGG + Intronic
1080276479 11:30508731-30508753 ACGTTTGGCCCTTTGTCTGTGGG - Intronic
1084683641 11:70681218-70681240 GCGTGGGGTCCCTTTTCTCTTGG + Intronic
1086311664 11:85542256-85542278 AGGTGGTGCCCCATTTCTTTTGG - Intronic
1087090371 11:94264861-94264883 AAGTGGGACCCTATCTCTTTAGG - Intergenic
1089869042 11:121656210-121656232 AAGCAGGGCCCTTTTACTTTCGG + Intergenic
1090310887 11:125737599-125737621 TCGTAGATCCCTTTTTCTTTAGG - Intergenic
1093953194 12:25187721-25187743 CCTTGGGGACCTTTTTGTTTTGG - Intronic
1096187518 12:49591415-49591437 AGGTGGGCAGCTTTTTCTTTCGG - Intronic
1096543674 12:52322674-52322696 ACTTTGGGCCCTTGTTCCTTTGG + Intergenic
1102585547 12:113920312-113920334 ACGTGGGCCCCTCTTTCTGGTGG - Intronic
1103004882 12:117413230-117413252 TTGTGGGGCCCTTATTCTGTTGG + Intronic
1104017424 12:124970421-124970443 GCCTGGTGCCTTTTTTCTTTTGG - Intronic
1105978265 13:25492833-25492855 AGGTGGGGCCCAGTTTCCTTTGG + Intronic
1108397803 13:50007196-50007218 ACGCTGGGCCCTATTTTTTTGGG - Intronic
1112462214 13:99613195-99613217 CCAGGGAGCCCTTTTTCTTTTGG - Intronic
1116911250 14:50467176-50467198 ACGTGTGACCCATTTTCTTGTGG + Intronic
1118024163 14:61751741-61751763 ACTTGGTGCCGTTTTTATTTTGG + Intergenic
1118984022 14:70738294-70738316 ACGTCCGTCCCTTCTTCTTTGGG + Exonic
1120524233 14:85559290-85559312 AAGAGGGGCCCTTTCTCCTTCGG + Intronic
1120817306 14:88875580-88875602 ACGTGGTTCCCTTTAGCTTTCGG - Intronic
1125040954 15:35186812-35186834 AACTGGGGCCCCTTTTCCTTTGG + Intergenic
1126080293 15:44954412-44954434 TTGTGGTTCCCTTTTTCTTTAGG - Intergenic
1135417354 16:22278743-22278765 GCGGAGGGCTCTTTTTCTTTGGG - Intronic
1137335935 16:47549001-47549023 ACGTGGAAACCTTTTTCTTTAGG + Intronic
1140526295 16:75625694-75625716 ACCTGGTGCCATATTTCTTTGGG + Intergenic
1153440828 18:5117459-5117481 ATATGGGGCCCTTTTACTTGTGG - Intergenic
1156641219 18:39101638-39101660 TCGTGGGGCCCTTTGTTTTATGG + Intergenic
1163461668 19:17441707-17441729 ACATGGGGGACTTTTTTTTTTGG + Intronic
1163710184 19:18841882-18841904 GCGAGAGGCCCTTTCTCTTTGGG + Intronic
1167507143 19:49876797-49876819 AGGCGGGGCCATTTTTCTTAGGG - Exonic
925754318 2:7119278-7119300 ATGTTGGGCCTTTTCTCTTTTGG - Intergenic
927368792 2:22330576-22330598 AGGGGCTGCCCTTTTTCTTTTGG + Intergenic
929821724 2:45279636-45279658 AGGTGGAGCTCCTTTTCTTTGGG - Intergenic
935317708 2:101853079-101853101 ACTTGGGGCCTTATTTCCTTTGG - Intronic
942394167 2:175528655-175528677 ACTTGGAGGCTTTTTTCTTTTGG + Intergenic
944663082 2:201937440-201937462 ACATGAGGCTCTCTTTCTTTGGG + Intergenic
948385207 2:237576555-237576577 AGCTGGGGCCTTTTCTCTTTGGG + Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1177068404 21:16469035-16469057 ACACTGAGCCCTTTTTCTTTTGG - Intergenic
1179634269 21:42697220-42697242 ACTTTGGGCCCTTTGTCTGTAGG - Intronic
1184402754 22:44283299-44283321 AGGTGGGACACTTTTCCTTTTGG - Intronic
949122921 3:409240-409262 ACGTGATTACCTTTTTCTTTTGG + Exonic
953988070 3:47460964-47460986 ACCTGGGCCCCTTTTCCTTGGGG + Intronic
960889018 3:122426664-122426686 ATGTGGCTCCCTTTTTCTTGTGG - Exonic
962332686 3:134493467-134493489 ACATGGGAACCTTTTTCTTTAGG + Intronic
963067761 3:141277520-141277542 AAGAGGTGCTCTTTTTCTTTCGG - Intronic
967194738 3:187016600-187016622 ACGTTTGGACATTTTTCTTTGGG - Intronic
968750809 4:2387926-2387948 ATGTGGGGCCCTTTTCCTGTGGG - Intronic
968846100 4:3042298-3042320 ACTTGGGGTCTTTATTCTTTGGG + Intergenic
970625620 4:17875727-17875749 ACTTGGGGACCTATTTTTTTTGG + Intronic
971329865 4:25673567-25673589 ACCTGGGGTCCTTTTTCTAAGGG - Intronic
974005392 4:56551349-56551371 TTCTGGGACCCTTTTTCTTTGGG + Intronic
974014179 4:56634055-56634077 GCGTGGGCCACTTTTTTTTTTGG - Intergenic
976046439 4:80953947-80953969 ATATGGGTCCCTTTTACTTTTGG - Intronic
981874894 4:149530133-149530155 AGATGGGGACATTTTTCTTTGGG - Intergenic
989427143 5:41309061-41309083 ACAATGTGCCCTTTTTCTTTAGG + Exonic
999462802 5:151771556-151771578 AGGTGGGGCCCGTGTACTTTGGG - Intronic
1001123986 5:169002998-169003020 CAGTGGGGCACTTATTCTTTGGG + Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1005352083 6:24946694-24946716 CCTTGGGCCCCTATTTCTTTTGG - Intronic
1005845202 6:29771656-29771678 TAGTGGGGCACTATTTCTTTAGG + Intergenic
1005850521 6:29817352-29817374 TAGTGGGGCGCTATTTCTTTAGG + Intergenic
1005857371 6:29872759-29872781 CAGTGGGGCACTATTTCTTTAGG + Intergenic
1005863126 6:29916598-29916620 TAGTGGGGCACTATTTCTTTAGG + Intergenic
1007985998 6:46207181-46207203 ATGTGGGTCACTTTTTTTTTTGG - Intergenic
1009486144 6:64224918-64224940 AAGAGGGGCCATTTTTCCTTGGG - Intronic
1019268631 7:133713-133735 ACCTGGAGCCCTTTTTCTTGAGG + Intergenic
1024529400 7:50378876-50378898 ACCTGGGACCCTTTATATTTAGG - Intronic
1027751995 7:82161025-82161047 ACAAGGTGCCCTGTTTCTTTGGG - Intronic
1028364602 7:90012877-90012899 ATGTGGGGCCCTGTTTATCTAGG - Intergenic
1031661977 7:124436659-124436681 ACGTGGGGCCTCTTTTTTCTAGG + Intergenic
1034041073 7:147877020-147877042 ACGTGGGGCTGTTTGTCATTGGG + Intronic
1037727401 8:21494426-21494448 AGGTGGGCCCCTTTTTCCTCAGG + Intergenic
1038056020 8:23858419-23858441 AAGTTGGACCATTTTTCTTTGGG + Intergenic
1057212150 9:93206218-93206240 ATGTAGGGCCCCATTTCTTTGGG + Intronic
1060960298 9:127676066-127676088 CCTAGGGGCCCTTTTTGTTTGGG + Intronic
1061066675 9:128282552-128282574 TCGTTGGGCGCTTTCTCTTTGGG + Intronic
1203781763 EBV:104901-104923 ACTCGGGGCCCTTTTTGGTTTGG - Intergenic
1186431676 X:9510392-9510414 AGGAGGGGGGCTTTTTCTTTAGG + Intronic
1187856000 X:23636761-23636783 ACTTGGCTCCCTTTGTCTTTGGG - Intergenic