ID: 1172166677

View in Genome Browser
Species Human (GRCh38)
Location 20:32903811-32903833
Sequence CCATGGGAGTGGAGGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 458}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172166671_1172166677 -7 Left 1172166671 20:32903795-32903817 CCTGGGCTAGCAGTGGCCATGGG 0: 1
1: 1
2: 7
3: 63
4: 343
Right 1172166677 20:32903811-32903833 CCATGGGAGTGGAGGGAAGTAGG 0: 1
1: 0
2: 4
3: 58
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172166677 Original CRISPR CCATGGGAGTGGAGGGAAGT AGG Intronic
900595613 1:3478906-3478928 CCATGTGAGCAGAGGGAGGTGGG + Intronic
901478375 1:9506446-9506468 CCATGGGTGTGGAAGGAAATGGG - Intergenic
901685609 1:10941901-10941923 CCATGGGGGTGGGAGTAAGTGGG - Intergenic
901765330 1:11496464-11496486 CCATGGGGGTGGAGTGAGGTGGG - Intronic
902360047 1:15937418-15937440 ACAGGGGAGGGGAAGGAAGTCGG - Exonic
902699744 1:18163661-18163683 CAATGGGGTTGCAGGGAAGTTGG - Intronic
902863159 1:19260289-19260311 CCAAGGGCGTGGTGAGAAGTGGG - Intergenic
904163446 1:28537683-28537705 CTCTGGGAGTTCAGGGAAGTTGG - Intronic
904378692 1:30097119-30097141 CCATGGGAGGGGAGGGGAGGGGG - Intergenic
904602917 1:31683629-31683651 GTTTGGGAGTGGATGGAAGTAGG + Intronic
905961918 1:42050143-42050165 GGATGGGAGTAGAGGGAAGCTGG + Intergenic
906143648 1:43547712-43547734 TGAGGGGAGTGGAGGGAAGCGGG + Intronic
906346713 1:45020035-45020057 CCCTGGGGGTAGAGGGAGGTGGG + Intronic
906642952 1:47452459-47452481 CCATGGGAGTGCAGGGATGGTGG - Intergenic
906753964 1:48291495-48291517 CCAGGGAAGTGGGGGAAAGTCGG + Intergenic
907038200 1:51235423-51235445 GGTTGGGAGTGGAGGGAAGTGGG + Intergenic
907113804 1:51950896-51950918 CCATGGGAATGGAAGGAAACTGG + Intronic
907455922 1:54575406-54575428 CCTTGGGGGTGGAGGGAGGCAGG + Intronic
908220285 1:61999263-61999285 CCATAGGACAGGAAGGAAGTTGG - Intronic
908360932 1:63367791-63367813 CCCTGGGAGTGGAGCGGAGCTGG - Intronic
908669853 1:66533976-66533998 CGATGGGGGTGGAGGGGAATGGG + Intronic
909538083 1:76760625-76760647 CCTGGGGAGCAGAGGGAAGTGGG + Intergenic
912917386 1:113829099-113829121 ACATGGGAGTAGGGGGAAGCAGG - Intronic
912993061 1:114508731-114508753 CTATGGGAATGGAGGGATGGGGG - Intronic
915393087 1:155562183-155562205 CGATGAGAGTGCAGGGAAGTGGG + Exonic
915660480 1:157401014-157401036 CCCTGGGAAGGGAGGGCAGTTGG + Intergenic
916019185 1:160777746-160777768 CCAAGGGAGTGCAAGGGAGTGGG - Intergenic
916677039 1:167072852-167072874 GCCTGGGGGTGGAGGAAAGTGGG + Intronic
917246284 1:173004722-173004744 CCATGGTAGTGGGGGGAAGGTGG + Intergenic
917611032 1:176689202-176689224 CCATGGGAGAGGAGGAAAGCAGG + Intronic
918095371 1:181329944-181329966 CCAAGGGAGTGGAGGGGAGTAGG + Intergenic
918143566 1:181737474-181737496 GCATGGGCGTGGTGGGGAGTGGG + Intronic
919480783 1:198086218-198086240 ACAATGGAGTGGAGGGAAGTTGG - Intergenic
920030453 1:203034538-203034560 CTATGGGAGTGGGGGGCAGTGGG + Intronic
920526687 1:206672210-206672232 AGATAGGAGTGGAGGGAAGCGGG - Intronic
920746904 1:208637615-208637637 CCATAGGGGAGAAGGGAAGTGGG - Intergenic
921031451 1:211338430-211338452 TTATGGGAGTGGAGGAGAGTGGG - Intronic
921196599 1:212763174-212763196 CAAAGGGAGTGGAGAGTAGTGGG - Intronic
922088179 1:222370609-222370631 CCATGGGAAAGGAGAGAAGGAGG + Intergenic
922557832 1:226546514-226546536 GCATGGGAGCCCAGGGAAGTAGG - Intergenic
922585684 1:226733594-226733616 ACATGAGACTGGTGGGAAGTGGG - Intronic
922795473 1:228337481-228337503 CCATGGGACTCTAGGGAGGTGGG + Intronic
923173965 1:231445555-231445577 CCATGGAAGTGGGGGAAAGCTGG - Intergenic
923573705 1:235139989-235140011 CCCAGGGAGTGGAGGTCAGTGGG - Intronic
1062768780 10:83962-83984 CCAGGGGAGAGCAGGGAAGGGGG - Intergenic
1062945952 10:1462150-1462172 GCCTGGGGGTGGTGGGAAGTGGG - Intronic
1063208341 10:3855821-3855843 CCATGCGAGAGGACGGAGGTAGG + Intergenic
1063528151 10:6803580-6803602 CCCTGGGAGTGGTGGTATGTGGG - Intergenic
1063982708 10:11468633-11468655 GCGTGGGAGTGGAGGGGAGGAGG + Intronic
1064213209 10:13378100-13378122 TCATGGGAGTGGAGTTAAATTGG + Intergenic
1065130251 10:22613080-22613102 CAATGGGAGTGAAGGGAAAAGGG + Intronic
1065739520 10:28784556-28784578 CCATGGGATTGGGGGGAAGGAGG - Intergenic
1066287619 10:33983392-33983414 CCATTGTAGTGGAAGGAACTAGG - Intergenic
1066302004 10:34105538-34105560 TCATGGGAGTAGAGGGCAGGAGG - Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1069627964 10:69880125-69880147 CCATTGGAGTGGCGGGAAACAGG - Intronic
1069710300 10:70483561-70483583 CCATGGGAGGGGAGAGGGGTGGG + Intronic
1069957587 10:72061416-72061438 CCCTGGGGGCTGAGGGAAGTGGG + Exonic
1070875537 10:79803450-79803472 CAATGAAAGTGGAGTGAAGTTGG + Intergenic
1071569688 10:86690228-86690250 CACTGGGAGGGGAGGGAAGGAGG - Intronic
1072064917 10:91858560-91858582 CCTTGGGAGTGGAGTAGAGTGGG - Intronic
1072071817 10:91925138-91925160 CCATGGGAGTTGGGTGAAGGGGG + Intronic
1072306116 10:94108755-94108777 CCATGGGACTGGAAGGCAGCAGG - Intronic
1073467091 10:103700594-103700616 CCATGGGAGTGGGAGGAGGCAGG + Intronic
1073475943 10:103753540-103753562 GCTTGGAAGTGGAGGGAACTGGG + Intronic
1074917527 10:117971820-117971842 CCATTGAGGTGGAGGGGAGTGGG + Intergenic
1075097459 10:119481890-119481912 CCATGAGTGTGGAGGCAACTGGG + Intergenic
1075620973 10:123928075-123928097 ACATGGTGGTGGAGGGGAGTGGG - Intronic
1075791605 10:125088269-125088291 CCAGGATAGTGGAAGGAAGTTGG + Intronic
1076375814 10:129983933-129983955 CCAGGGAAGTGGAGGAAAGCTGG - Intergenic
1076429772 10:130393623-130393645 CCATGGGAGTGGAGAGGAATGGG - Intergenic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1079547517 11:21651707-21651729 CCATGGGAGTGGGGCCAGGTTGG + Intergenic
1080389750 11:31834106-31834128 CCATGGGAGTGGGTGGTAGCTGG + Intronic
1080923359 11:36731042-36731064 CCAGGGAAGTGGTGGGAAGCTGG - Intergenic
1081552329 11:44125396-44125418 CCCTGGGAGTGGAGGGGTTTAGG + Intronic
1081989768 11:47331670-47331692 CCAGGAGCCTGGAGGGAAGTTGG - Exonic
1082727608 11:56755287-56755309 CCATGAGGGTGGAGGAATGTAGG + Intergenic
1082856071 11:57807896-57807918 CTATGGGAGAGGAGGCAAGAAGG + Intronic
1083108946 11:60386237-60386259 GAATGGGAGTCGAGGAAAGTGGG - Intronic
1083375313 11:62215588-62215610 CCTTAGGTGTGGAGGGAAATGGG - Intergenic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1084591675 11:70094135-70094157 CCCTGGGAGTGGTGAGGAGTGGG - Intronic
1084682364 11:70673784-70673806 CCTAGTGAGTGGAGGGAGGTTGG - Intronic
1085184030 11:74560141-74560163 CCATGGGAGTGGATGGATGAAGG - Intronic
1085438324 11:76531922-76531944 CCTTGGGGGTGGAGGACAGTAGG - Intronic
1086292154 11:85323964-85323986 CCATGTAAGTGGATGGTAGTGGG + Intronic
1086950735 11:92887810-92887832 CCAGGGCAGGGGAGGGAAGCAGG + Intronic
1087013321 11:93533428-93533450 ACATGGCAGTGCAGGGAAGAAGG + Intronic
1087137383 11:94734654-94734676 CCCTGGGAGAGGAGGGGAGGAGG + Intronic
1088331268 11:108655147-108655169 CCTTGGGAGTGGACTGAATTTGG - Intergenic
1088409270 11:109515309-109515331 ACTTGAGGGTGGAGGGAAGTAGG - Intergenic
1088714269 11:112535055-112535077 ACATGGGGGTGGAGGGGAGAGGG + Intergenic
1088995075 11:114989114-114989136 ACCTGGGAGTGTAGGGAAGCGGG - Intergenic
1089078560 11:115758688-115758710 CGAGGGGAGTGGAGGCAAGGAGG + Intergenic
1089225026 11:116911991-116912013 CCATATGAGTGGAGCGAAGTTGG + Intronic
1089629262 11:119773893-119773915 CCATGTGAGTGGAGTGGGGTGGG + Intergenic
1090324163 11:125870481-125870503 CCTTAGGTGTGGAGGGAAATGGG + Intergenic
1090362350 11:126182345-126182367 GCATTGGAGTTGAGGGCAGTAGG - Intergenic
1090642223 11:128739545-128739567 CCTTGGGAATGGAGAGTAGTGGG - Intronic
1090949727 11:131463170-131463192 CCATGGGACAGGAGGGCAATAGG - Intronic
1091029583 11:132173343-132173365 CCATGAGTGTGCAGCGAAGTGGG + Intronic
1091566894 12:1655439-1655461 GCAGGGGAGTGGAGGGATGTGGG + Intergenic
1091590004 12:1837227-1837249 CGGTGGGAGGGGAGGGCAGTTGG + Intronic
1091728880 12:2865166-2865188 CCATGGAAGGGGAGGGAAGTGGG + Intronic
1091832055 12:3556951-3556973 CCATAGAAGTGGGGGAAAGTGGG + Intronic
1092223138 12:6729133-6729155 GAATGGGAGTGGAGGGCAGGTGG + Intronic
1092974272 12:13729213-13729235 GCATGGGAGTGGCGGGGAGGAGG + Intronic
1095501133 12:42839759-42839781 CCAGGGAAGTGGAGGAAAGCCGG + Intergenic
1095969913 12:47894550-47894572 GCAGGGGAGTGAAGGGAAGCAGG - Intronic
1096693723 12:53335967-53335989 CCATGGAAGGGGTGGGAAGCAGG + Intronic
1096820815 12:54232617-54232639 ACTTGGGAGCAGAGGGAAGTTGG + Exonic
1096968404 12:55646850-55646872 CCAGGGGAGTTGAGGGAAAATGG + Intergenic
1096996649 12:55842442-55842464 TGATGGGAGTGGAGGTAAGCAGG + Intronic
1099243571 12:80167250-80167272 CCGTGGGAGTGGTGGGGAGGTGG + Intergenic
1099351217 12:81571293-81571315 TCTTGGGAGTGGAAGGAAGAAGG + Intronic
1100371867 12:93975996-93976018 CCATGGGAATGAAGAGGAGTAGG - Intergenic
1100669529 12:96795549-96795571 CCAGGGAAGTGGAGGAAAGCTGG + Intronic
1100772926 12:97943177-97943199 CAAAGGAAGTGGAGGGAAGCTGG + Intergenic
1100951249 12:99852942-99852964 CCAGGGAAGTGGAGGAAAGCTGG - Intronic
1101345335 12:103880941-103880963 GCAGGGGAGTGGAGGGAAGGGGG - Intergenic
1101523047 12:105502669-105502691 CCGTGGGAGTGGCAGGAAATGGG + Intergenic
1101969774 12:109304833-109304855 AAATGGGAGTGGTTGGAAGTGGG + Intronic
1102200947 12:111057359-111057381 CTATGTGAGTGGAGTGGAGTGGG + Intronic
1102291978 12:111708327-111708349 CTAGGAGAGTGGAGGGAATTGGG - Intronic
1102418269 12:112783324-112783346 CCACGGGAGACCAGGGAAGTGGG - Intronic
1102571895 12:113831825-113831847 CGTGGGGAGTGGAAGGAAGTAGG + Intronic
1103322480 12:120100100-120100122 TCATGGGGGTGGAGGTAATTAGG - Intronic
1103446082 12:120996207-120996229 GCAGGGGAGGGCAGGGAAGTGGG + Intronic
1103526064 12:121569382-121569404 CCATGGGAGGGTAGGGAGGGTGG - Intronic
1104340124 12:127941253-127941275 TCATGGGAGTGGCTGGCAGTGGG - Intergenic
1104413392 12:128578140-128578162 CCACTGGCGTGGAGGGAAGCGGG - Intronic
1104623333 12:130334513-130334535 CCAGGGTAGTGGGGGGAAGAGGG + Intergenic
1105444395 13:20440103-20440125 GCATGAAACTGGAGGGAAGTTGG - Intronic
1105619848 13:22056172-22056194 CCATGGGGGTGGAGAGAAATGGG + Intergenic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1108179772 13:47829231-47829253 CCCTGGGAATGGAGGTAAGCTGG - Intergenic
1108734567 13:53269184-53269206 ACAAGGAAGTGGAGGGAAGTTGG + Intergenic
1109323027 13:60833328-60833350 CCATGGGGGTGGAGCCAAGATGG - Intergenic
1109768025 13:66930644-66930666 CCTTTGGAGGGGAGGGAAGAAGG + Intronic
1110484105 13:76017734-76017756 CCTTGCAAGTGGAGGGAAGTGGG + Intergenic
1110557555 13:76877617-76877639 CAATGGGGGTGGTGGGGAGTGGG - Intergenic
1110762980 13:79251269-79251291 GCCTGGGAGAGGAGGGAGGTGGG - Intergenic
1112780685 13:102897743-102897765 GGAAGGGAGTGGAAGGAAGTAGG + Intergenic
1114329025 14:21617630-21617652 CCAGGGAAGTGGGGGAAAGTCGG + Intergenic
1114438287 14:22726252-22726274 CCATGGGGGTTGAGGGGAGCAGG + Intergenic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1116043456 14:39714318-39714340 CCATGGGGATAGAGGGATGTGGG + Intergenic
1116495696 14:45557372-45557394 GCCTTGAAGTGGAGGGAAGTGGG + Intergenic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1118303534 14:64635886-64635908 CTATGGAAGTGGAGGGGAGATGG - Intergenic
1118988906 14:70780421-70780443 GCATGGGAGATGTGGGAAGTGGG - Intronic
1119382639 14:74239078-74239100 GCATAGGAGTTGAGGGAAGGAGG + Intergenic
1119949987 14:78735100-78735122 CCAGGGATGTGAAGGGAAGTCGG + Intronic
1120393114 14:83933088-83933110 ACATGTGAGTGGATGGAATTTGG - Intergenic
1121303242 14:92888611-92888633 CCATGGAGGTGGAGAAAAGTGGG + Intergenic
1121586981 14:95069201-95069223 CCATGGTGGTGGAGGGACATGGG + Intergenic
1121822757 14:96984617-96984639 CCATGGTAATGGAGAGAAGACGG + Intergenic
1122248365 14:100420230-100420252 CCAAGCCAGTGGAGGGAAGTGGG - Intronic
1122738974 14:103859883-103859905 CCAGGGGACTGCAGGGAGGTGGG - Intergenic
1122859440 14:104575983-104576005 CCACGGGTGGGGAGGGAGGTGGG - Intronic
1125822884 15:42648760-42648782 TAATGGTAGTGGAGGGAAGGGGG - Intronic
1126668934 15:51098471-51098493 CCATGGGACTGTAGGTAAGCTGG + Intronic
1127395399 15:58540666-58540688 TCAGGGGAGAGGAGGAAAGTTGG - Intronic
1127854236 15:62941567-62941589 GCAGGGGAGTGAAGGGAAGCAGG - Intergenic
1128591976 15:68906216-68906238 CCCAGGGAGTGGAGGGAGATGGG - Intronic
1129118462 15:73379856-73379878 CCATGGGAGTGGATGGCTGGGGG - Intergenic
1129186363 15:73909530-73909552 CCTGGGAAGTGGAGGGAAGGTGG + Intergenic
1129200014 15:73993110-73993132 GCATGGGAGTGTAAGGAAGAAGG + Intronic
1129225710 15:74169261-74169283 TCAGGGGAGGGGAGGGAAGAAGG + Intergenic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129263545 15:74382157-74382179 CCAGGGAAGTGGAGGGCAGGTGG + Intergenic
1129530097 15:76258668-76258690 CCATGGGTGTGGATGGCAGTGGG - Intronic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1130130199 15:81134530-81134552 CCTTGGGAGTTTAGAGAAGTGGG - Intronic
1130991970 15:88880933-88880955 CGATGGGAGTGGTGGGGACTGGG - Intronic
1131501862 15:92975523-92975545 CCATGGGATTTGAGAGAAGTGGG + Intronic
1132304371 15:100800868-100800890 CCATAGGAGGGTAGGGAAGCAGG + Intergenic
1132457636 16:32986-33008 CCAGGGGAGAGCAGGGAAGGGGG - Intergenic
1133058913 16:3161670-3161692 CCACGGGAGCTGAGGGAGGTGGG - Intergenic
1133809123 16:9147649-9147671 CCATGGGAGTGGTTAGAACTTGG + Intergenic
1134212473 16:12289304-12289326 CCAAGGGAGAGGAGGGAAGAAGG - Intronic
1134435872 16:14256492-14256514 CCATGGGAGAGCAAGGAAGAAGG - Intronic
1134839651 16:17391632-17391654 CCCTGGGAGTAAAGGGATGTTGG - Intronic
1135011310 16:18881939-18881961 TCATGGGAGGGTAGGGGAGTTGG + Intronic
1135318215 16:21469521-21469543 TCATGGGAGGGTAGGGGAGTTGG + Intergenic
1135371108 16:21901316-21901338 TCATGGGAGGGTAGGGGAGTTGG + Intergenic
1135440678 16:22469399-22469421 TCATGGGAGGGTAGGGGAGTTGG - Intergenic
1136011152 16:27364041-27364063 CCATGAGAGTAGAGGGCACTGGG + Exonic
1136070672 16:27785141-27785163 CCCCGGGAATGGAGGGAAGTGGG - Intergenic
1136328422 16:29550963-29550985 TCATGGGAGGGTAGGGGAGTTGG + Intergenic
1136375232 16:29861454-29861476 GCATGAGAGTGGAGGGAACAGGG + Intronic
1136443107 16:30290981-30291003 TCATGGGAGGGTAGGGGAGTTGG + Intergenic
1137375912 16:47951732-47951754 CCATGGTGGTGGAGAGAAGGAGG - Intergenic
1138221401 16:55254759-55254781 CTATGGGGGAGGAGGGAAATGGG - Intergenic
1138458281 16:57133429-57133451 CCAGGGGAGGGGAGGGCACTGGG + Intronic
1138708421 16:58941399-58941421 CGATTGGAGAGGAGGAAAGTGGG - Intergenic
1139009650 16:62616702-62616724 CCATGGTTGAAGAGGGAAGTGGG + Intergenic
1139222887 16:65202477-65202499 CCAGGGGAGTGGGGAGATGTTGG + Intergenic
1139297907 16:65919047-65919069 CCAGGGAGGTGGAGGTAAGTGGG - Intergenic
1139674442 16:68513530-68513552 CCCTTGGAGTGGAGAGAGGTGGG + Intergenic
1139889834 16:70243401-70243423 TCATGGGAGGGTAGGGAAGTTGG + Intergenic
1141469417 16:84228525-84228547 CCATGGGAGCGGAGTAAAGGAGG - Intronic
1142408402 16:89903831-89903853 CCATGTGTGTGGAGGGTGGTGGG + Intronic
1142501497 17:335738-335760 ACCTGGGAGGGGAGGGGAGTGGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144499156 17:15770285-15770307 CCGTGGGAGTAGAGGGAGGTGGG + Intergenic
1145162538 17:20585321-20585343 CCGTGGGAGTAGAGGGAGGTGGG + Intergenic
1145371646 17:22311324-22311346 CCAGGGGAGTACAGGGGAGTTGG + Intergenic
1145707797 17:26938309-26938331 GAATGGGAGTGGAGTGGAGTGGG + Intergenic
1145888783 17:28400328-28400350 AAATGGGAATGGAGGGAAATAGG + Exonic
1146937901 17:36824018-36824040 ACGTGGGAGGGGAGGGAACTAGG - Intergenic
1147121096 17:38335471-38335493 CCTTGGGGGTAGAGGGGAGTGGG + Intronic
1147134258 17:38426058-38426080 CCATGGGGGAGGAGGGAGGGTGG - Intergenic
1147773679 17:42885421-42885443 CTATAGGAGAGGAGGGAAGGAGG - Intergenic
1148455939 17:47811388-47811410 CCATGGGAGGGCAGTGCAGTCGG - Intronic
1148463540 17:47851351-47851373 CCCTGGGAGTGGAGGGGACCAGG - Intronic
1149849362 17:60026205-60026227 CCAGTGGAGTGGGGCGAAGTCGG - Intergenic
1149853203 17:60054115-60054137 CCAAGGCTGTGCAGGGAAGTGGG - Intronic
1149860806 17:60120319-60120341 CCAGTGGAGTGGGGCGAAGTCGG + Intergenic
1151708810 17:75787946-75787968 TTATGGGGGTGGAGGGAAGCAGG - Intronic
1152789838 17:82273120-82273142 CCAGGGGTGGGGAGGGCAGTGGG - Intronic
1152961664 18:83795-83817 CCAGGGGAGAGCAGGGAAGGGGG - Intergenic
1154136676 18:11785872-11785894 CCAGGGGAGTGGGAGGAAGGTGG - Intronic
1154355298 18:13619942-13619964 GGGTGGGAGTGGAGGGCAGTGGG - Intronic
1155570229 18:27184920-27184942 CCACTGAAGTGAAGGGAAGTGGG + Intronic
1156474581 18:37397548-37397570 CCATGGGTGGGGAGGGATGGAGG + Intronic
1156848538 18:41698672-41698694 CCCAGGGAGTGGAGGGAGATAGG + Intergenic
1157279466 18:46336041-46336063 CCATGGGGGTGAGGGGGAGTGGG + Intronic
1157854242 18:51090400-51090422 GCATGGGATGGGAGGTAAGTAGG + Intergenic
1160403688 18:78629676-78629698 CCATGGGAGTGGAGGGGAGATGG + Intergenic
1161154325 19:2724256-2724278 CCTTTGGAGAGGAGGGCAGTGGG + Intronic
1161358349 19:3832084-3832106 CCATGGGGGAGGAGGGCTGTGGG + Intronic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1162866663 19:13553166-13553188 CCCAGGGAGTGGAGAGAAGCTGG - Intronic
1162878759 19:13641130-13641152 CCGTAGTGGTGGAGGGAAGTAGG - Intergenic
1163136822 19:15317592-15317614 CAATGGGAGTGGGGGGTGGTGGG + Intronic
1164918806 19:32073165-32073187 CCAAGGGAGTGGAGTGAAAGTGG - Intergenic
1165104487 19:33460883-33460905 GGATGGGGGTGGAGGGAAGGTGG + Intronic
1165461575 19:35946935-35946957 GCAGGAGAGTGGAGGGAAGCTGG + Intergenic
1165539372 19:36478953-36478975 CCATGGGAGCTGAGAGAAATAGG + Intronic
1165757779 19:38304358-38304380 CCAGGGCTGTGGAGAGAAGTTGG - Exonic
1166094583 19:40530810-40530832 CCAAGGGAGGGGAGCGAAGCGGG + Intronic
1166255267 19:41599812-41599834 CCCTGGGAGTGGATGGGAGGAGG + Intronic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166614442 19:44230526-44230548 CCATGGAAGAGAAGGGAACTTGG - Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1168394723 19:56038301-56038323 CCAGGGGTGAGGAAGGAAGTTGG + Intronic
925342616 2:3147706-3147728 CCCAGGGAGTGAAGGGAAGCAGG + Intergenic
925606132 2:5662019-5662041 CCAAGGGAAGGGAGGGAAATGGG + Intergenic
925661519 2:6208316-6208338 CCCTGGGAGTAGAGGGAGGGAGG + Intergenic
926326238 2:11786652-11786674 CCATGCTAGAGGAGGGAACTGGG + Intronic
927138370 2:20113603-20113625 CCAGGGGAAGGGAGGGAGGTAGG + Intergenic
927495870 2:23551403-23551425 ACATGGGAAGGGAGGGAAATGGG + Intronic
928467607 2:31537371-31537393 CCATGGGAGGAGGGGGAAGGAGG - Intronic
928939619 2:36714526-36714548 CCATGGCACTGGAGGGAGGGGGG + Intronic
930043209 2:47145328-47145350 CCTTGGCAGTGGAGTGAGGTGGG - Intronic
930140098 2:47942818-47942840 CCTTGAGAGTAGAGTGAAGTAGG + Intergenic
930218353 2:48720342-48720364 TGATGGGAGTGGAGTGAAGTAGG - Intronic
930244662 2:48970924-48970946 TCACAGGAGAGGAGGGAAGTAGG - Intronic
932326301 2:70864267-70864289 CCATGTGGATGGAGAGAAGTAGG - Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935146795 2:100401113-100401135 AGATGGGAGGTGAGGGAAGTGGG - Intronic
935160357 2:100524343-100524365 CCTTGGGAGTCTAGAGAAGTTGG + Intergenic
935886712 2:107628456-107628478 CCATGGGTTTGGGGGGAAGTGGG - Intergenic
935947814 2:108301902-108301924 CTAGGGGACTGGAGTGAAGTTGG + Intronic
936407095 2:112214545-112214567 CAAGGGGAGCAGAGGGAAGTAGG + Exonic
937274541 2:120675402-120675424 GCAGGGGAGTGGAGGGAAAGGGG + Intergenic
939417952 2:141924844-141924866 CTATGGCAGTGGGTGGAAGTGGG + Intronic
939529165 2:143335932-143335954 CCAGGGGAGAGGAAGGAAGCTGG + Intronic
940471304 2:154104195-154104217 CCATGGGGGTGGGGGGATGGTGG + Intronic
941409921 2:165142131-165142153 CCCTGGGTGTGAAGAGAAGTAGG - Intronic
942307316 2:174621492-174621514 CGATGGGGGTGGAGGGGAGGGGG - Intronic
942560517 2:177213346-177213368 GCCTGGGATTGGAGGGAAGAGGG + Intronic
942977264 2:182033010-182033032 CAATTGGAGTGGAGTGAATTTGG - Intronic
944508273 2:200438114-200438136 CCATGGGAGTAGAGAGAAGCAGG + Intronic
944762491 2:202831423-202831445 AGTTGGGAGTGGAGGGAAGGAGG - Intronic
944898946 2:204195185-204195207 CCAGGGAAGTGGAAGGAGGTGGG - Intergenic
945160923 2:206889685-206889707 TCTTGAGAGTGGAGGGAAGGAGG - Intergenic
945273470 2:207964485-207964507 CCATGAGAGTGGAGGGAGGGAGG + Intronic
946658643 2:221976324-221976346 CAATGGAAGTAGTGGGAAGTGGG - Intergenic
946738425 2:222777362-222777384 CGATGGAAGTGGTGGGAAATGGG - Intergenic
947447983 2:230179318-230179340 GCATGGGGGTGGAGGGTAGTGGG + Intronic
947948942 2:234131055-234131077 TCATGTGTGTGGAGGGCAGTGGG + Intergenic
948601578 2:239110798-239110820 GCAGGGGAGAGGAGGGAAGGAGG - Intronic
948618148 2:239214841-239214863 GCATGGGACTGGAGAGAAATAGG + Intronic
948839619 2:240642570-240642592 CCATGGGGGCGGAGGGGCGTGGG - Intergenic
948871916 2:240805027-240805049 GGAGGGGAGGGGAGGGAAGTGGG + Intronic
949058373 2:241942179-241942201 CCAGGGGAGTGGGAGGAGGTGGG + Intergenic
1169150390 20:3285010-3285032 GAATGGGAGTGGAGGGCAGGAGG - Intronic
1170906058 20:20516064-20516086 CAATGGGAGTGGAGAGTAGCAGG - Intronic
1172107165 20:32523710-32523732 CCAGGGCAGCGGAGGGCAGTTGG - Intronic
1172166677 20:32903811-32903833 CCATGGGAGTGGAGGGAAGTAGG + Intronic
1172667928 20:36613669-36613691 TCATGGCACTGGAAGGAAGTAGG + Exonic
1172781302 20:37438420-37438442 GCAGGAGAGTGGAGGGAAGAGGG - Intergenic
1172907904 20:38382913-38382935 TCATGAGAGTGGAGTGAAGCAGG + Intergenic
1173002945 20:39118548-39118570 CCAGGGAAGTAAAGGGAAGTAGG + Intergenic
1174277962 20:49417359-49417381 CCATGTGAGAGAAGGGTAGTAGG - Intronic
1174336067 20:49861641-49861663 CCCTGGGAGTAAAGGGCAGTAGG + Intronic
1174724870 20:52851121-52851143 TCATGGGGGTGGAGGGGTGTTGG - Intergenic
1175296481 20:57912377-57912399 CCTTGGGAGAGGGAGGAAGTGGG - Intergenic
1176521196 21:7825784-7825806 CCAGGGGAGAAGAGGGCAGTGGG + Exonic
1176968030 21:15233600-15233622 TCATGGGGGTGGAGGGGAGGGGG + Intergenic
1177775403 21:25561426-25561448 AGATGGGAGTGGAGGGCAGGGGG + Intergenic
1178233347 21:30812882-30812904 CCCTGGGACTCGAGGTAAGTTGG + Exonic
1178377568 21:32080192-32080214 CCAAGGGAGTGGAGGGGACCAGG - Intergenic
1178511305 21:33207197-33207219 CCATGGGAGGGAAGGGCAGGTGG - Intergenic
1178655216 21:34455796-34455818 CCAGGGGAGAAGAGGGCAGTGGG + Intergenic
1179922292 21:44513764-44513786 CCAGGGGAGGGGAGGGAGGCAGG + Intronic
1181093089 22:20487614-20487636 CAATGGAAGTGGAGGGATGCAGG + Intronic
1182280513 22:29215453-29215475 CCATGGGTGTCCAGGGCAGTGGG + Intronic
1183583304 22:38738269-38738291 CAAAGAGAGCGGAGGGAAGTGGG + Intronic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1184065092 22:42114050-42114072 CCATAGATGTGGAGGGAAATGGG + Intergenic
1184685501 22:46094993-46095015 CCAGGGGAGGGGAGGGGAGACGG - Intronic
1184919658 22:47596822-47596844 TCATGGGAGAGGAGGGAAGAGGG - Intergenic
1185337856 22:50278744-50278766 ATATGGGAGTGGTGGGCAGTGGG - Intronic
949165160 3:931597-931619 CCATGGAGGTGGGGAGAAGTGGG - Intergenic
949260671 3:2099478-2099500 CCTGGGGAGTGGAGGGACCTGGG + Intronic
949480376 3:4488631-4488653 CCTTGTGAGTGGAGGGAACATGG - Intergenic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950625638 3:14244695-14244717 CCATGGGCGTGGAGAGCAGCAGG + Intergenic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
951989509 3:28661106-28661128 CCTAGGGAGCGGAGGAAAGTGGG - Intergenic
952497249 3:33926639-33926661 CTATGGAAGAGGAGGGGAGTGGG - Intergenic
952889706 3:38031711-38031733 CCCTGGGAGTTGAGGGCAGAGGG - Intergenic
953610342 3:44442652-44442674 CCAAGGGAGTGGGGGAAAGGTGG + Exonic
953814578 3:46144046-46144068 CCAAAGCAGTGGAGGGAGGTAGG - Intergenic
957030048 3:75229648-75229670 CCATGGGAGTGTTGGAAAATGGG - Intergenic
958484693 3:94689696-94689718 GAAGGGGAGTGAAGGGAAGTTGG + Intergenic
961554591 3:127689355-127689377 ACCTGGAAGTGGAGGGAAGCTGG + Exonic
962081586 3:132145040-132145062 CAATATGAGTGGAGGGTAGTGGG - Intronic
962292038 3:134145410-134145432 TCAGGGGAGTGGAGGGCAGGGGG + Intronic
962436122 3:135368389-135368411 CCAGGGGAGTAGAGGGAGTTGGG + Intergenic
962695035 3:137939550-137939572 CCTTGGGAGTGATGGTAAGTGGG + Intergenic
962912481 3:139866037-139866059 CCATGGGAGTGGAAAGGAGCAGG - Intergenic
966304895 3:178520602-178520624 CCATGTGAGTGCTGGGAATTTGG - Intronic
966339369 3:178908219-178908241 GCTTAGGAGTGGAGGGAAGCTGG - Intergenic
967319734 3:188183728-188183750 CCATGGGAGGGGGTGGGAGTGGG + Intronic
967492085 3:190104351-190104373 TCACTGGAGTGGAGGGGAGTGGG - Intronic
968506056 4:972031-972053 CCATGGCAGAGGAGGGACCTGGG - Intronic
968743379 4:2342839-2342861 CAATGGGAAAGGAGAGAAGTGGG + Intronic
969044585 4:4327685-4327707 CCCTGGGAGTTCAGGGAAGAGGG - Intergenic
969167699 4:5331067-5331089 CTATGGGAGTGGAGGGGAAGGGG - Intronic
969500077 4:7547329-7547351 CTCTGGAAGTGGAGGGAAGTGGG - Intronic
969515710 4:7647084-7647106 CCAGGGGACGAGAGGGAAGTAGG + Intronic
969554499 4:7897048-7897070 CCTTGGGAGTGGATAGAATTAGG - Intronic
970282927 4:14478395-14478417 CCAGGGAAGTGGGGGGAAGCTGG - Intergenic
970284618 4:14496179-14496201 TCAAGGGAGTGGAGGGGAGGTGG + Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
971848546 4:31951686-31951708 CCATGGCGGTGGAGTGAAATTGG - Intergenic
972245301 4:37240890-37240912 CCATCACAGTGAAGGGAAGTAGG + Intergenic
972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG + Intronic
972775563 4:42236728-42236750 CCCTGGGAGGGGAAGGGAGTGGG + Intergenic
973030174 4:45327737-45327759 ACATGGGAGTGGAGAGAACATGG + Intergenic
975871305 4:78781617-78781639 CCCTGGGAGAGGATGGATGTAGG + Intronic
977298750 4:95242580-95242602 CCATGGCAGTGGATGGCAGGTGG - Exonic
977539082 4:98293676-98293698 GCGGGGGCGTGGAGGGAAGTAGG - Intronic
979226512 4:118291955-118291977 CCAGGTGAGGGGAGGGAACTTGG + Intronic
980953284 4:139402927-139402949 ACATGGAAATGGAGAGAAGTTGG - Intronic
981912528 4:149998201-149998223 GCATGGAAGTAGAGGGAAGCAGG - Intergenic
982288209 4:153756566-153756588 CCATAGGGGTGGAGAGAAGGGGG - Intronic
982653128 4:158112317-158112339 ACAATGCAGTGGAGGGAAGTGGG + Intergenic
983489488 4:168371906-168371928 CCATGGGGGTTGAGGGAAATAGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985542167 5:492258-492280 ACAGGGGAGGGGAGGGAGGTCGG + Intronic
985542224 5:492386-492408 ACAGGGGAGGGGAGGGAGGTCGG + Intronic
985644246 5:1077662-1077684 GCATGGGAGTGGTGGGAGGTGGG - Intronic
985791019 5:1926799-1926821 CCATGGGGGAGGAGGGAAGGAGG - Intergenic
988421213 5:31008205-31008227 CCAGGGAAGTAGAGGAAAGTTGG + Intergenic
988721819 5:33886753-33886775 CCATAGGTGTGGATGGAAATCGG + Intronic
989099487 5:37810914-37810936 CCGTGAGTGTGGAGTGAAGTAGG - Intergenic
990953832 5:61324209-61324231 GAAGGGGAGGGGAGGGAAGTGGG + Intergenic
991470017 5:66957878-66957900 CCCTGGGCAAGGAGGGAAGTAGG - Intronic
991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG + Intergenic
992940177 5:81752460-81752482 CTATGGGAGGAGAGGGAAATCGG + Intergenic
994060127 5:95466371-95466393 CCATTGCAGTGGAGGCAAATAGG - Intronic
994347205 5:98700882-98700904 CCAAGGAAGTGGGGGAAAGTTGG - Intergenic
994871013 5:105350724-105350746 CCAGGGAAGTGGGGGAAAGTTGG + Intergenic
995268588 5:110194717-110194739 CCATGGGAGTGGAGGGGTCGTGG - Intergenic
996141428 5:119913814-119913836 CCTTGGGAGTGGAAGGCAGGAGG - Intergenic
996191392 5:120547077-120547099 TCATGGTGCTGGAGGGAAGTGGG + Intronic
997241641 5:132312271-132312293 ACATGGGAGGGGAGGAAGGTGGG + Intronic
998396079 5:141818937-141818959 CAATGGGATTGGAGGCCAGTGGG + Intergenic
998471328 5:142386228-142386250 CCATGGGGATGAAGGGAAGGAGG + Intergenic
998487544 5:142516291-142516313 CCATGGCAGAGGAGGAAGGTGGG - Intergenic
998593904 5:143507583-143507605 GAAGGGGAGTGAAGGGAAGTGGG - Intergenic
999119807 5:149200509-149200531 CCACGGGCCTGGAGGGAAGTGGG + Intronic
999186040 5:149709699-149709721 CTGTGGCAGTGGAGGTAAGTGGG + Intergenic
1000026116 5:157360585-157360607 TCATGGGACTGCTGGGAAGTTGG + Intronic
1001109059 5:168880391-168880413 TCATGGGAGTGGAGGGATCTGGG - Intronic
1001180609 5:169516542-169516564 CCATGGGAGTGGAGGGTTCCAGG - Intergenic
1002321313 5:178377666-178377688 CCATGGGAGTGGCGTGGAGGTGG + Intronic
1002451448 5:179321352-179321374 GCAAGGGAGTGGAGGGAAGCTGG - Intronic
1003094588 6:3132333-3132355 GCCTGAGAGAGGAGGGAAGTCGG - Intronic
1003520893 6:6857377-6857399 CCAAGGGCGTGGAGGGTATTTGG - Intergenic
1003860660 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG + Intergenic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860757 6:10319690-10319712 CCATGGGGATGGAGGAACGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1004180819 6:13379117-13379139 CCCAGGGAGTGGTGGGAAGATGG + Intronic
1004331630 6:14727207-14727229 GTATGGGGGTGGAGGGAAATAGG + Intergenic
1004348104 6:14866890-14866912 ACATGGGAGTGGGGGGAGGTGGG - Intergenic
1005138398 6:22598443-22598465 TCATGGGAGTGGATGGAGGTGGG - Intergenic
1005480727 6:26252939-26252961 CCATGAGGGTGGAGGAATGTGGG - Intergenic
1006601994 6:35232412-35232434 CAATGAGAGTGGAGGGTAATTGG - Intronic
1006902387 6:37511597-37511619 ACATGGCAGAGGAGGGAGGTGGG - Intergenic
1007745689 6:44041714-44041736 CGCTGGGGGTGGAGGGAGGTGGG - Intergenic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1009796994 6:68481774-68481796 GTAGGAGAGTGGAGGGAAGTGGG + Intergenic
1009834388 6:68980298-68980320 CCATAAGAGTAGAGGAAAGTAGG - Intronic
1009866896 6:69409055-69409077 CCAGGGAAGTGGAGGAAAGCTGG - Intergenic
1010175017 6:73017930-73017952 CCCTAGGAGTGCAGGGCAGTAGG + Intronic
1010263452 6:73842211-73842233 TCATGGGGATGGGGGGAAGTGGG - Intergenic
1010306449 6:74328765-74328787 CAATGGGAATGAAGAGAAGTTGG - Intergenic
1011271209 6:85581151-85581173 CCATTTGATTGGAGGAAAGTGGG + Intronic
1011965886 6:93156872-93156894 CCATGGGAGTGGGGGAAAACTGG + Intergenic
1012990691 6:105922777-105922799 CCATGGGATTGGAGTGATGTGGG + Intergenic
1013414355 6:109911744-109911766 CCATGGTAGAGGTGGGAAGGAGG + Intergenic
1013526887 6:110982325-110982347 CCGTGGGATGGGAGGGATGTGGG + Intronic
1015635237 6:135268250-135268272 CCTAGGGAGAGAAGGGAAGTTGG + Intergenic
1016178870 6:141119218-141119240 CCATGTGAGTGGAGGTAAAAAGG + Intergenic
1016894150 6:149036173-149036195 CCCTGGCTGTGGAGGGAACTGGG + Intronic
1016910154 6:149190715-149190737 CCAGGGAAGTGGTGGAAAGTTGG + Intergenic
1018240319 6:161767785-161767807 GGATGGGAGTGCAGGGAGGTAGG + Intronic
1018663558 6:166112845-166112867 CCATAGGAGTGCAGAGAAATTGG - Intergenic
1018937175 6:168281104-168281126 CCACGGGTGGGGAGGGAAGGCGG + Intergenic
1019627364 7:2024506-2024528 CTATGGGAGTTGAAGGAAATTGG - Intronic
1019760475 7:2808660-2808682 CCATGGGAGCAGCAGGAAGTAGG - Intronic
1021360533 7:19707453-19707475 CCATTGGAGAGGAGGGCAGGGGG - Intronic
1021989574 7:26128996-26129018 CCATGGGAGGGGAGGAAAGTGGG + Intergenic
1023347200 7:39283422-39283444 GCTTGGGAGTGGAGGGAATGGGG - Intronic
1023869310 7:44254336-44254358 CCTTGGGCGTGGAGGGGAGGTGG + Intronic
1023956627 7:44891820-44891842 CCAGTGGAGAGGAGGGAAGTTGG + Intergenic
1024004553 7:45215970-45215992 ACATGGGCGGGGAGGGAAGAGGG + Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024562389 7:50655557-50655579 CTAGGGCAGTGGAGTGAAGTTGG - Intronic
1024993545 7:55254594-55254616 CCGTGGGAGTGGAGGGCACTGGG - Intronic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1025610336 7:63071841-63071863 CCATGGAAGGAGAGGGAAATTGG - Intergenic
1025941833 7:66080853-66080875 CCAAGGGAGTGGTAGGAATTGGG + Intronic
1026215284 7:68342966-68342988 CAATGGGAGTGATGAGAAGTGGG + Intergenic
1026828441 7:73597530-73597552 CCATGGGAGGGAAGGGAGGTGGG + Exonic
1027440637 7:78215704-78215726 CCATGGGAATGGAGGAAAAGGGG + Intronic
1028018650 7:85744517-85744539 CCTTAGGTGTGGAGGGAAGTGGG + Intergenic
1029676672 7:102074608-102074630 CAGTGGGAGTGGCGGGAATTTGG - Intronic
1029893813 7:103960039-103960061 CCAGAGAAGTGGAGGGGAGTGGG - Intronic
1031983090 7:128142319-128142341 CCATGGGAGGGGTGGGAGGTGGG - Intergenic
1032359707 7:131244130-131244152 CCTGGGGAGTAGAGGGAAATCGG - Intronic
1032849588 7:135782658-135782680 GGATGGGAAAGGAGGGAAGTGGG - Intergenic
1035399512 7:158555610-158555632 CCATGGGAGCTGAGGGAGGCTGG - Intronic
1036696128 8:10976311-10976333 CCATGGCAGGGGAAGGAAGGAGG - Intronic
1037826350 8:22162815-22162837 CAAGGGGAGTGGAGGGGAGGAGG + Intronic
1038485172 8:27930010-27930032 CCATGGGATTGTAGGGCATTTGG - Intronic
1039469063 8:37802531-37802553 CCCTGGGTGGGGAGGGGAGTGGG - Intronic
1041697196 8:60748420-60748442 CCATGGCACTGGAGGGCACTAGG + Intronic
1042456442 8:69010342-69010364 GGATGGGAGTGGAGGGTGGTGGG - Intergenic
1042928709 8:73992784-73992806 CCAAAGGAGGAGAGGGAAGTGGG - Intronic
1043383157 8:79724087-79724109 CCAAGGGACTGGATGGAAGAAGG - Intergenic
1044399368 8:91752782-91752804 CCAGGGTCGTGGAGGGAAGGAGG - Intergenic
1045864164 8:106845806-106845828 CTATGGCAGTGGAGGGTAGGGGG - Intergenic
1046124069 8:109882353-109882375 TCATGGGAGTGCAGTGAAGCAGG - Intergenic
1047197901 8:122738129-122738151 TCCTGGGAGGGGAAGGAAGTGGG - Intergenic
1047449533 8:124952526-124952548 CTAAGGGAGTGAAGGGAAGGAGG - Intergenic
1048681477 8:136846243-136846265 CCTTGGGAGTAGAGGGGAGAGGG + Intergenic
1049170813 8:141159568-141159590 CCATGTGAGTGGGAGGAAGTAGG - Intronic
1049797815 8:144504583-144504605 CCCTGGGAGGGGAGGGGAGCAGG - Exonic
1050415137 9:5408806-5408828 CCAAGGCTGTGCAGGGAAGTGGG - Intronic
1052303055 9:26974939-26974961 CCTTAGGTGTGGAGGGAAATGGG + Intronic
1052465305 9:28822113-28822135 CCATGGGACTGGAGGGCATAAGG - Intergenic
1053096178 9:35329855-35329877 CCATGGCAGAAGAGGGAAGAGGG + Intronic
1053361069 9:37486856-37486878 CCCTGGGAGTGGGTGGATGTGGG + Intronic
1053437553 9:38086550-38086572 CCAGGGGAGAGAAGAGAAGTGGG + Intergenic
1054903798 9:70397044-70397066 GCATGGAAGTGGAGGGCAGTAGG + Intronic
1055020420 9:71663559-71663581 GCATGGAAGTGGAGGGTAGTAGG - Intergenic
1056260500 9:84843424-84843446 TCCTGGGAGTGAAGGGCAGTGGG - Intronic
1056268622 9:84924771-84924793 CCATAGGAGTGGAGGGAGAAAGG - Intronic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1057858468 9:98621150-98621172 GCATGGCAGTCCAGGGAAGTGGG + Intronic
1059008939 9:110435467-110435489 AGATGGGGGTGGAGGGAAGCAGG + Intronic
1059246894 9:112856459-112856481 GCATGGGTGTGGAGGGGAGTGGG + Intronic
1059303074 9:113331150-113331172 GCATGGGAGTGGATGGGGGTGGG + Intronic
1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG + Intronic
1059791871 9:117649025-117649047 CGCTGGCAGTGGAGGGGAGTAGG - Intergenic
1061009531 9:127946749-127946771 AAAAGGGAGTGGAGGGAAGCTGG + Intronic
1061330740 9:129890643-129890665 CCCTGGGAGGGGAGGGTAGTGGG + Intronic
1061498554 9:130989679-130989701 CCATGGGAGAGGAGGGCAGGGGG - Intergenic
1062319283 9:135982517-135982539 CCAGGGGAGTGGAGGTAACGGGG + Intergenic
1062572095 9:137190447-137190469 CCTTGGGAGAGGAGGGAGGAGGG + Intergenic
1062736487 9:138140325-138140347 CCAGGGGAGAGCAGGGAAGGGGG + Intergenic
1185965686 X:4599396-4599418 CCATGCAAGTTCAGGGAAGTGGG + Intergenic
1187475319 X:19605584-19605606 CCAAGTGAGTGGAGGCAAGGGGG - Intronic
1188741651 X:33790751-33790773 CCCTGGGACAGGAGGGGAGTTGG - Intergenic
1188801830 X:34541720-34541742 CTGAGAGAGTGGAGGGAAGTTGG - Intergenic
1190076375 X:47320271-47320293 GCATGGGGCTTGAGGGAAGTTGG - Intergenic
1190106807 X:47566948-47566970 GGATGTGAGTGGAGGTAAGTGGG - Intronic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1194231558 X:91331312-91331334 CCAGGGAAGTGGGGGAAAGTTGG - Intergenic
1195460303 X:105116100-105116122 CCCTGCAAGTGGAGGGAAGCCGG + Intronic
1195743707 X:108092080-108092102 CCTAGGGAGTGGAAAGAAGTGGG + Intronic
1196098857 X:111827930-111827952 CCAAGGGAGGAGAGGGAAGTAGG - Intronic
1196679249 X:118454000-118454022 CAATGGGAGTGGAAGGTGGTGGG + Intergenic
1196873008 X:120130365-120130387 CGATGGGAATGGAGGTAAGCAGG + Intergenic
1197590009 X:128397061-128397083 CAAGAGGAGGGGAGGGAAGTGGG - Intergenic
1198319254 X:135503620-135503642 ACATGAGAGTGGAGGGTGGTAGG - Intergenic
1198762106 X:140043026-140043048 GCAAGGGAATGGAGGCAAGTGGG - Intergenic
1198820713 X:140645283-140645305 GCAAGGGAGTGGTGGGGAGTAGG + Intergenic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1199699754 X:150366238-150366260 AGATGGGAGGGGAGGGGAGTAGG - Intronic
1200116010 X:153770012-153770034 CCATGGGAGAGGAAGGAGGACGG - Intronic
1200128705 X:153830040-153830062 CCACGGGTGGGGTGGGAAGTTGG - Intronic
1200398725 X:156006414-156006436 CCAGGGGAGAGCAGGGAAGGGGG + Intronic
1201104623 Y:10754313-10754335 TGATTGGAGTGGAGTGAAGTGGG - Intergenic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic
1201795203 Y:17889669-17889691 CACTGGGAGTGCTGGGAAGTGGG + Intergenic
1201806352 Y:18016315-18016337 CACTGGGAGTGCTGGGAAGTGGG - Intergenic
1201856116 Y:18545106-18545128 ACATGGGTGTGGAGGAAAGAGGG - Intergenic
1201877205 Y:18775279-18775301 ACATGGGTGTGGAGGAAAGAGGG + Intronic
1202356645 Y:24058751-24058773 ACTTGGGAGTGTTGGGAAGTGGG + Intergenic
1202514133 Y:25611359-25611381 ACTTGGGAGTGTTGGGAAGTGGG - Intergenic