ID: 1172168399

View in Genome Browser
Species Human (GRCh38)
Location 20:32913308-32913330
Sequence CTGTAAACTTACATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1077
Summary {0: 2, 1: 4, 2: 14, 3: 170, 4: 887}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172168394_1172168399 22 Left 1172168394 20:32913263-32913285 CCTGGTGAGGGCCTACTTCCTGA 0: 1
1: 3
2: 30
3: 165
4: 465
Right 1172168399 20:32913308-32913330 CTGTAAACTTACATGGTGGAAGG 0: 2
1: 4
2: 14
3: 170
4: 887
1172168396_1172168399 4 Left 1172168396 20:32913281-32913303 CCTGATTCATAGACAGCTGTCTT 0: 4
1: 27
2: 68
3: 157
4: 410
Right 1172168399 20:32913308-32913330 CTGTAAACTTACATGGTGGAAGG 0: 2
1: 4
2: 14
3: 170
4: 887
1172168395_1172168399 11 Left 1172168395 20:32913274-32913296 CCTACTTCCTGATTCATAGACAG 0: 5
1: 30
2: 114
3: 299
4: 783
Right 1172168399 20:32913308-32913330 CTGTAAACTTACATGGTGGAAGG 0: 2
1: 4
2: 14
3: 170
4: 887

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172168399 Original CRISPR CTGTAAACTTACATGGTGGA AGG Intronic
900662626 1:3792818-3792840 CTGGACACTTACATGATGTAAGG + Intronic
900874171 1:5329796-5329818 CTGTATCCTCACATGGTGGAAGG + Intergenic
901170964 1:7256934-7256956 CTGCATCCTTACATGGTGGGAGG + Intronic
901908899 1:12438302-12438324 CTGTAACCTCACACGGTAGAAGG - Intronic
902445808 1:16463437-16463459 CTGTAACCTCACATGGTAGAAGG + Intergenic
902907743 1:19571210-19571232 CTGTATCCTCACATGGTGGAAGG - Intergenic
903388732 1:22948145-22948167 CTGTATCCTCACATGGTGGAAGG - Intergenic
903441521 1:23391518-23391540 CTGTAACCTCACATGGTGGAGGG - Intronic
904664922 1:32112851-32112873 CTGTAATCTTTGCTGGTGGAGGG + Intronic
904798599 1:33076597-33076619 CTGCATAATTTCATGGTGGAAGG + Intronic
905020378 1:34806873-34806895 CTGTATCCTCTCATGGTGGAAGG + Intronic
905534019 1:38704872-38704894 TTGTAATCTTACATGGCAGAAGG - Intergenic
906646235 1:47477486-47477508 ATGTTACCTTACATGGTGAAAGG - Intergenic
907469040 1:54660227-54660249 CTGTATCCCTACATGGTGGTAGG + Intronic
907485313 1:54774040-54774062 CTGCATGCTCACATGGTGGAAGG + Intergenic
907598664 1:55745002-55745024 CTGTATCCTCACATGGTGGAAGG + Intergenic
907693366 1:56694630-56694652 CTGTAACTTCACATGGTGAAAGG + Intronic
907756293 1:57313886-57313908 CTGTAACTTCACACGGTGGAAGG - Intronic
907810600 1:57865983-57866005 CTGTGTCCTCACATGGTGGAGGG + Intronic
907877263 1:58503660-58503682 TTGTAACCTCACATGGTAGAAGG - Intronic
907928343 1:58975570-58975592 CTGTATCCTCACATGATGGAAGG + Intergenic
907945215 1:59129698-59129720 CTGTATCCTCACATGGTGGAAGG - Intergenic
908176351 1:61559022-61559044 TTGTAACCTCACGTGGTGGAAGG + Intergenic
908388904 1:63667921-63667943 CTGTGTCCTGACATGGTGGAAGG + Intergenic
908554632 1:65245552-65245574 CTGTGTCCTCACATGGTGGAAGG + Intergenic
908740239 1:67319900-67319922 CTGCGACCTCACATGGTGGAAGG - Intronic
908905684 1:69006194-69006216 CTGTGTCCTCACATGGTGGAAGG + Intergenic
908905853 1:69007932-69007954 CTGTGTCCTCACATGGTGGAAGG + Intergenic
908962950 1:69723801-69723823 CTGTAACCTCACATGGTAGAAGG + Intronic
909026255 1:70485714-70485736 ATGTTATCTTACATGGTGAAAGG + Intergenic
909052419 1:70782637-70782659 CTGCATCCTCACATGGTGGAAGG - Intergenic
909134607 1:71782219-71782241 CTGAGTCCTTACATGGTGGAAGG - Intronic
909167687 1:72249179-72249201 CTGTGTTCTCACATGGTGGAAGG - Intronic
909198327 1:72655776-72655798 CTGTGTTCTCACATGGTGGAAGG - Intergenic
909233141 1:73117649-73117671 CTGTATATTTATATGGTGGGAGG + Intergenic
909589899 1:77335933-77335955 CTGTGCACTCACATGGTGAAAGG + Intronic
909707477 1:78604673-78604695 CTCTAATCTCACATGGTGGAAGG - Intergenic
909735837 1:78960774-78960796 CTGTACCCTTGCAGGGTGGAAGG - Intronic
910011455 1:82468752-82468774 CTGTATCCCCACATGGTGGAAGG + Intergenic
910236259 1:85039390-85039412 CTGTATTCTTACATGATGGAAGG - Intronic
910399825 1:86827339-86827361 TTGTATTCTTACATGGTGGAAGG - Intergenic
910499642 1:87875313-87875335 CTGTGTCCTTACATGGTGGTAGG + Intergenic
910593175 1:88950055-88950077 CTGTGTCCTTACATGGTGGAAGG - Intronic
910792285 1:91063955-91063977 CTGCAAAGTTATATGGTGAAAGG - Intergenic
911197590 1:95011290-95011312 CTGTACTCTTAAATGGTAGAAGG - Intronic
911264590 1:95728004-95728026 CTGTATAATTCCATGATGGAAGG + Intergenic
911317702 1:96375430-96375452 CTCTATCCTCACATGGTGGAAGG - Intergenic
911386140 1:97177938-97177960 CTGTATCTTCACATGGTGGAAGG + Intronic
911453145 1:98091410-98091432 CTGCATAATTCCATGGTGGAAGG - Intergenic
911709995 1:101060766-101060788 CTGTGTCCTTACATAGTGGAAGG + Intergenic
912174098 1:107137215-107137237 TTGTATTCTCACATGGTGGAAGG - Intergenic
912269708 1:108196721-108196743 CTGTGTCCTCACATGGTGGAAGG + Intronic
912695642 1:111840081-111840103 CTGCATCCTCACATGGTGGAAGG + Intronic
912720889 1:112019014-112019036 CTGTGTCCTCACATGGTGGAAGG - Intergenic
912908726 1:113734833-113734855 CTGTGTCCTCACATGGTGGAAGG - Intronic
913162921 1:116161668-116161690 CTGTGTCCTCACATGGTGGAAGG - Intergenic
913346326 1:117814450-117814472 TTGTATCCTCACATGGTGGAAGG - Intergenic
913386210 1:118260710-118260732 CTGTAACCTCACATGGTAGAAGG - Intergenic
913460728 1:119083292-119083314 CTGTGTCCTTACATGGTAGAGGG - Intronic
913575542 1:120170016-120170038 CTGTTTCCTCACATGGTGGATGG - Intronic
913649206 1:120894441-120894463 CTGTGCCCTCACATGGTGGAAGG - Intergenic
914172399 1:145237606-145237628 CTGTGTCCTCACATGGTGGAAGG + Intergenic
914297277 1:146340072-146340094 CTGTGTCCTCACATGGTGGAAGG + Intergenic
914384155 1:147151374-147151396 CTGTGTTCTTACATGGTAGAAGG + Intergenic
914527044 1:148478609-148478631 CTGTGTCCTCACATGGTGGAAGG + Intergenic
914557852 1:148785658-148785680 CTGTTTCCTCACATGGTGGATGG - Intergenic
914614982 1:149344572-149344594 CTGTTTCCTCACATGGTGGATGG + Intergenic
914639354 1:149588526-149588548 CTGTGTCCTCACATGGTGGAAGG - Intergenic
915083894 1:153371326-153371348 CTGTGTCCTCACATGGTGGAAGG + Intergenic
915647524 1:157284360-157284382 CTGTGTCCTCACATGGTGGAAGG + Intergenic
915647530 1:157284390-157284412 CTGTGTCCTCACATGGTGGAAGG + Intergenic
915647580 1:157284698-157284720 CTGTATTCTCACATGGTGGAAGG + Intergenic
915663137 1:157420189-157420211 CTGTGTCCTCACATGGTGGAAGG - Intergenic
915754797 1:158249401-158249423 ATGTGTCCTTACATGGTGGAAGG + Intergenic
916539223 1:165736097-165736119 CTGCATCCTCACATGGTGGAAGG - Intronic
917685953 1:177416268-177416290 CTGTGTCCTCACATGGTGGAAGG - Intergenic
918111246 1:181457184-181457206 CTGTAACCTTACAAGGTGTAAGG + Intronic
918356949 1:183713628-183713650 CTGTGACCTCACATGGTAGAAGG - Intronic
919139172 1:193548948-193548970 CTGCAAAATTGCATGGTGAAAGG + Intergenic
919322943 1:196065848-196065870 CTGTTTCCTTACATGGTGGAAGG - Intergenic
920581081 1:207108596-207108618 CTTAAAACTTACACGGAGGAAGG + Intronic
920747250 1:208640578-208640600 TTGTATCCTTACATCGTGGAGGG - Intergenic
920909181 1:210198298-210198320 CTGCATCCTTACATGGTAGAAGG + Intergenic
921249749 1:213285850-213285872 CTGCATCCTCACATGGTGGAAGG - Intergenic
921887093 1:220317982-220318004 CTGTGTCCTCACATGGTGGAAGG + Intergenic
921892498 1:220367214-220367236 TTGTATACTCACATGGTGAAGGG + Intergenic
922346582 1:224701422-224701444 CTGCAGCCTTACATGGTGGAGGG + Intronic
922541171 1:226421136-226421158 CTGTAACCTCACATGATGAAAGG + Intergenic
922552677 1:226507955-226507977 CTGGAAACTGACATCCTGGAGGG + Intergenic
922824636 1:228509128-228509150 CTGTGTCCTCACATGGTGGAAGG - Intergenic
922885711 1:229019007-229019029 CTGTGTCCTCACATGGTGGAAGG + Intergenic
923057934 1:230441914-230441936 CTAAAAACTCACATTGTGGACGG + Intergenic
923091650 1:230745589-230745611 CTGTGTCCTCACATGGTGGAAGG + Intergenic
923108316 1:230870864-230870886 CTGTAAGGTCACACGGTGGATGG - Intergenic
923221952 1:231903409-231903431 CTGTAGATTTACATGGAGTAAGG + Intronic
923394972 1:233552790-233552812 CTGTGTCCTCACATGGTGGAAGG - Intergenic
923757378 1:236804321-236804343 CTGTATCTTCACATGGTGGAAGG - Intronic
923899717 1:238312394-238312416 CTGTGTCCTCACATGGTGGAAGG + Intergenic
923900231 1:238318310-238318332 CAGGAAACTTACATGGTGGAAGG - Intergenic
923967121 1:239154445-239154467 CTGTAATCTTAAATGGCAGAAGG - Intergenic
924072652 1:240297912-240297934 CTGTAACCTCACATGGTAGAAGG + Intronic
924124695 1:240838225-240838247 CTGTTTCCTCACATGGTGGAAGG + Intronic
924131437 1:240912943-240912965 CTGCATACTTACAGGGAGGAAGG + Intronic
924221708 1:241883399-241883421 CTGTGTCCTTACATGGTAGAGGG + Intronic
924330461 1:242935971-242935993 CTGTGTCCTCACATGGTGGAAGG - Intergenic
924690749 1:246347707-246347729 CTGTGACATCACATGGTGGAAGG - Intronic
924863514 1:247952477-247952499 CTGTGACCTCACATGGTAGAAGG - Intronic
924867990 1:248006764-248006786 CTGTGACCTCACATGGTAGAAGG - Intronic
924872533 1:248064297-248064319 TTGTAACCTCACATGGTAGAAGG - Intronic
1063031511 10:2239866-2239888 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1063159790 10:3410761-3410783 CTGTGTCCTTGCATGGTGGAAGG - Intergenic
1063168786 10:3487269-3487291 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1064286506 10:13996101-13996123 CTGTGTCCTCACATGGTGGAAGG + Intronic
1064801746 10:19082999-19083021 CTGTGTTCTCACATGGTGGAAGG + Intronic
1064874514 10:19977719-19977741 CTGTAACCTCACATGGCAGAGGG + Intronic
1064934087 10:20660694-20660716 CTGTGTGCTCACATGGTGGAAGG - Intergenic
1065433563 10:25684135-25684157 CTGCATCCTCACATGGTGGAAGG + Intergenic
1065663438 10:28030987-28031009 CTGTATCCTCACATGGTTGATGG - Intergenic
1066184727 10:32998156-32998178 CTGTGTCCTCACATGGTGGAAGG + Intronic
1066385626 10:34939048-34939070 CTGTGTCCTTACATGGTGGAGGG + Intergenic
1066475156 10:35739561-35739583 CTATAACCTTACATGGTAGAAGG + Intergenic
1067306256 10:45066930-45066952 CTGTATCCTAACATAGTGGAAGG + Intergenic
1068068793 10:52169381-52169403 CTGTAACCTCACATGGCAGAAGG + Intronic
1068288550 10:54971341-54971363 CTGTGTTCTTACATGGTAGAAGG - Intronic
1068293094 10:55031740-55031762 CTGTATCCTCACATGGTGGAAGG - Intronic
1068437754 10:57014636-57014658 CTGTGACCTGACTTGGTGGAAGG - Intergenic
1068567430 10:58591458-58591480 CTGTAACCTCACATGATGGAAGG + Intronic
1068590797 10:58851021-58851043 CTGCAAGCTCACATGGTGGAAGG - Intergenic
1068781051 10:60919576-60919598 CTGTTGATTTAAATGGTGGAAGG - Intronic
1069376176 10:67795210-67795232 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1069389465 10:67918380-67918402 CTGTTAACTTACATTGTTTAAGG + Exonic
1069562572 10:69441226-69441248 CTATAAAAGAACATGGTGGAAGG - Intergenic
1069730274 10:70607029-70607051 CTGTGACCTCATATGGTGGAAGG - Intergenic
1070532476 10:77349250-77349272 CTGTGTCCTCACATGGTGGAAGG - Intronic
1071055600 10:81505404-81505426 ATGCCAACTTACATGGTGTAAGG + Intergenic
1071200577 10:83217631-83217653 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1071860234 10:89664834-89664856 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1071884130 10:89931007-89931029 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1071899150 10:90100383-90100405 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1072000431 10:91190166-91190188 CTGTGACCTCACATAGTGGAAGG + Intronic
1072171093 10:92862491-92862513 CTGCATCCTCACATGGTGGAAGG - Intronic
1072465427 10:95657914-95657936 CTGTATCCTCACGTGGTGGAAGG - Intergenic
1072642373 10:97221612-97221634 CTGTAACCTCACATGGTGGAAGG - Intronic
1073001546 10:100289597-100289619 CTGTGCCCTTTCATGGTGGAAGG - Intronic
1073202606 10:101748482-101748504 CTGTAAACCTACTTGGTGACTGG + Intergenic
1073765308 10:106675865-106675887 CTGTATCCTCACGTGGTGGAAGG - Intronic
1073874214 10:107902471-107902493 CTGTAGCCTTACATGGCAGAAGG - Intergenic
1074625433 10:115178720-115178742 CTGTGTCCTCACATGGTGGAAGG - Intronic
1075141476 10:119840920-119840942 CTGTAAATTTTCCTAGTGGAAGG + Exonic
1077977506 11:7263310-7263332 CTGTGTCCTCACATGGTGGAAGG + Intronic
1078056659 11:8014795-8014817 CTGTATCCTCACTTGGTGGAAGG + Intergenic
1078146515 11:8725264-8725286 CTGTGTTCTTACATGGTGGAAGG - Intronic
1078499017 11:11850884-11850906 CTGTGTCCTCACATGGTGGAAGG + Intronic
1078712129 11:13803622-13803644 CTGTAATCTCACACAGTGGAAGG - Intergenic
1079075549 11:17383406-17383428 CTGTAATCTTACATGGTGGAAGG - Intergenic
1079091589 11:17484348-17484370 CTGTAAACTTACATGGTGGAAGG - Intergenic
1079526634 11:21397869-21397891 CTCTAACCTCACATGGTGGAAGG - Intronic
1079551271 11:21701459-21701481 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1079852719 11:25557626-25557648 TTGAAAACTTACATGTTTGAAGG + Intergenic
1080095759 11:28404465-28404487 CTGTATCCTCACATGGTGGAAGG + Intergenic
1080195487 11:29603631-29603653 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1080257855 11:30312392-30312414 GTGTATTCTCACATGGTGGAAGG + Intergenic
1080294090 11:30705274-30705296 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1080335333 11:31188976-31188998 CTGCATCCTCACATGGTGGAGGG - Intronic
1080450098 11:32371941-32371963 CTGTGTCCTTACATGGTGGAGGG - Intergenic
1080492698 11:32783579-32783601 CTGTGTCCTCACATGGTGGAAGG + Intronic
1080542324 11:33279848-33279870 CTGTATCCTTACGTGGTAGAAGG + Intronic
1080610147 11:33896910-33896932 CTGTAAATCTACATGGTAGAAGG - Intergenic
1081059486 11:38455651-38455673 CTGTGATCTCACATGGTGGAAGG - Intergenic
1081174635 11:39912453-39912475 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1081439137 11:43061251-43061273 CTGCATCCTCACATGGTGGAAGG + Intergenic
1082008870 11:47437288-47437310 CTGTGTTCTTGCATGGTGGAAGG - Intergenic
1082867378 11:57912239-57912261 CTGTGTCCTTACACGGTGGAAGG - Intergenic
1082874778 11:57977325-57977347 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1082943146 11:58729121-58729143 CTGTGGTCTTACATGGTGGATGG - Intronic
1083542016 11:63518102-63518124 CTGTAATCTCACATGGTGGTAGG - Intergenic
1085250242 11:75138681-75138703 CTGTGTCCTCACATGGTGGAAGG + Intronic
1086219220 11:84421114-84421136 CTATAACCTTACAAGGTTGAAGG - Intronic
1086299047 11:85404580-85404602 AGAAAAACTTACATGGTGGAAGG + Intronic
1086742602 11:90386289-90386311 CTGCATCTTTACATGGTGGAAGG - Intergenic
1086790429 11:91030733-91030755 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1086962042 11:92987769-92987791 TTGTAATCTCACATGGTGAAAGG - Intergenic
1087476464 11:98641753-98641775 TTGTATCCTCACATGGTGGAAGG + Intergenic
1087477721 11:98657977-98657999 CTGTGTATTCACATGGTGGATGG - Intergenic
1087570443 11:99920694-99920716 CTGTGTACTCACATGGTGGAAGG + Intronic
1088499082 11:110464394-110464416 CTGCATCATTACATGGTGGAAGG + Exonic
1089132132 11:116220468-116220490 TTGTGTCCTTACATGGTGGAAGG - Intergenic
1089188111 11:116634828-116634850 CTGTGACTTCACATGGTGGAAGG + Intergenic
1089827024 11:121287317-121287339 CTGTAAACTCACATGGCAGCAGG + Intergenic
1090433687 11:126668233-126668255 CTGTGTCCTTACATCGTGGAAGG + Intronic
1090517285 11:127442390-127442412 CTATAACCTCACATGATGGAAGG - Intergenic
1091022087 11:132109362-132109384 CTGTGTCCTCACATGGTGGAAGG - Intronic
1091958260 12:4667108-4667130 CTGTGTGCTCACATGGTGGAAGG + Intronic
1092080413 12:5711382-5711404 CAGGAAGCTTTCATGGTGGAAGG - Intronic
1092123364 12:6059595-6059617 CTGTGTCCTCACATGGTGGAAGG + Intronic
1092350707 12:7753512-7753534 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1092561485 12:9618739-9618761 CTGCATCCTTACATGGTGGAGGG + Intergenic
1092787709 12:12043238-12043260 CTGTATCCTTACATGGCAGAAGG + Intergenic
1092949523 12:13488335-13488357 TTGTGACCTCACATGGTGGAAGG - Intergenic
1093051817 12:14512838-14512860 CTGTGACCTCACATAGTGGAAGG - Intronic
1093400455 12:18740197-18740219 CTGTGACCTTACATGGTAAAAGG + Intergenic
1093598608 12:20993353-20993375 CTGTAATCTCACATGCTGGAAGG - Intergenic
1093909291 12:24727297-24727319 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1094442872 12:30498659-30498681 CTGTGACCTCACATGGTGGAAGG - Intergenic
1094542455 12:31373764-31373786 CTGTGCACTCACATGGTGGAAGG - Intergenic
1094670718 12:32566202-32566224 CTATAACCTCACAGGGTGGAAGG + Intronic
1095126317 12:38482128-38482150 CTGAACCCTCACATGGTGGAAGG - Intergenic
1096349044 12:50878953-50878975 CTGTATCCTTACGTGGTGGAAGG - Intronic
1096384545 12:51186379-51186401 CTGTAACCTCACATGGTGGAAGG - Intergenic
1097503998 12:60441235-60441257 CAGAAACCTTACATGCTGGAGGG + Intergenic
1097644867 12:62224443-62224465 CTGTGTCCTTACATGGTGGAAGG + Intronic
1098235524 12:68414547-68414569 CTGTGGTCTCACATGGTGGAAGG - Intergenic
1098492264 12:71095344-71095366 CTGTGTCCTCACATGGTGGAAGG + Intronic
1098536387 12:71597963-71597985 CTGTGTTCTTATATGGTGGAAGG - Intergenic
1098647710 12:72925031-72925053 CTCTAAACTTAAATTTTGGATGG + Intergenic
1098660796 12:73091115-73091137 CTGTGTCCTTACATGGCGGAAGG + Intergenic
1099047336 12:77737765-77737787 TTGAATTCTTACATGGTGGAAGG - Intergenic
1099391698 12:82088472-82088494 TCATAAACTTACATGGGGGAAGG + Intergenic
1099494473 12:83329041-83329063 CTGTATCCTCACATGGTAGAAGG - Intergenic
1099773116 12:87089440-87089462 CTGTATCTTCACATGGTGGAAGG + Intergenic
1099825945 12:87778425-87778447 CTGCTATCTTACATGGTAGAAGG - Intergenic
1099990785 12:89718761-89718783 CTGTGTCCTTACATGGTAGAAGG - Intergenic
1100027704 12:90150199-90150221 CTGGAACCTCACATGGTGGAAGG - Intergenic
1100288084 12:93186823-93186845 CTATGACCTCACATGGTGGAAGG - Intergenic
1100372874 12:93984818-93984840 CTGTAACCTTATATGGCAGAAGG - Intergenic
1100665603 12:96749227-96749249 ATGTGTCCTTACATGGTGGAAGG + Intronic
1101260610 12:103025892-103025914 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1101385017 12:104249217-104249239 CTGTGTCCTCACATGGTGGAAGG + Intronic
1101734569 12:107453455-107453477 CTGTGTTCTCACATGGTGGAAGG - Intronic
1102414325 12:112747311-112747333 CTGTGTCCTCACATGGTGGAAGG - Intronic
1102750823 12:115292514-115292536 CTGTAACCTCACATGGCCGAAGG + Intergenic
1103076409 12:117986316-117986338 CTGTACCCTCACATGGTGGAAGG - Intergenic
1103966451 12:124642964-124642986 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1104128778 12:125872799-125872821 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1104167208 12:126244212-126244234 CTGTGTCTTTACATGGTGGAAGG + Intergenic
1104236363 12:126941752-126941774 CTGTGTCCTCACATGGTGGAGGG + Intergenic
1105064444 12:133184437-133184459 CTACATCCTTACATGGTGGAAGG + Intronic
1105660744 13:22491747-22491769 ATTTTAACTTACATGGTGAAAGG + Intergenic
1105660951 13:22494584-22494606 ATTTTAACTTACATGGTGAAAGG + Intergenic
1106223504 13:27767455-27767477 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1106782723 13:33075887-33075909 CTGTGTACTCACATGGTAGAAGG + Intergenic
1106797877 13:33226045-33226067 CTGTGCCCTCACATGGTGGAGGG - Intronic
1107371363 13:39753255-39753277 CTGTAACGTCACATGGTAGAAGG - Intronic
1107400823 13:40067311-40067333 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1107600127 13:42004617-42004639 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1107741104 13:43451376-43451398 CTGTGTACTTACATTGTGGTGGG - Intronic
1107817654 13:44258512-44258534 CTGTGCCGTTACATGGTGGAAGG - Intergenic
1108017348 13:46089729-46089751 CTATATATTCACATGGTGGAAGG - Intronic
1108156457 13:47590357-47590379 TTGTATCCTTACATGGAGGAAGG + Intergenic
1108156831 13:47593697-47593719 CTGTATCCTCACATGATGGAAGG + Intergenic
1108334729 13:49427883-49427905 CTGTATCCTCACATAGTGGAAGG + Intronic
1108415659 13:50195998-50196020 CTGCATTCTCACATGGTGGAAGG + Intronic
1108687773 13:52835740-52835762 TTGTAAACTGCCATGGTGCATGG - Intergenic
1109436730 13:62313254-62313276 CTTTAACCTCACATGGTAGAAGG - Intergenic
1109478094 13:62911506-62911528 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1109658737 13:65430138-65430160 CTGCATCCTCACATGGTGGAAGG - Intergenic
1109837639 13:67879395-67879417 CTGTAACCTCACATGTTGGAGGG + Intergenic
1109874256 13:68378723-68378745 CTGCACTCTTACATGGTGCAAGG + Intergenic
1110603307 13:77401572-77401594 CTGTGTTCTTACATGGTGGAAGG + Intergenic
1110918804 13:81058450-81058472 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1111117636 13:83801782-83801804 CTGTATCCTTACATGGTGAAAGG - Intergenic
1111260563 13:85734377-85734399 CTGTGTCCTCACATGGTGGAGGG - Intergenic
1111523406 13:89434691-89434713 CTGCATCCTAACATGGTGGATGG + Intergenic
1111608994 13:90578985-90579007 CTGTGTCCTCACATGGTGGAGGG + Intergenic
1111720301 13:91935423-91935445 CTGTGTCCTCACATGGTGGAAGG - Intronic
1111731693 13:92085005-92085027 GTGTGTCCTTACATGGTGGAAGG + Intronic
1112028916 13:95439287-95439309 CTGCATCCTCACATGGTGGAAGG + Intronic
1112523745 13:100122874-100122896 CTGTGTCCTCACATGGTGGAAGG + Intronic
1112657460 13:101467038-101467060 CTGTATCCTCACATGTTGGAAGG + Intronic
1112698882 13:101981322-101981344 CTGTGTCCTTACATGGCGGAAGG - Intronic
1112826311 13:103396729-103396751 TTGTATCCTTACATGATGGAGGG + Intergenic
1112914024 13:104523479-104523501 CTCTGTCCTTACATGGTGGAAGG - Intergenic
1113395662 13:109945256-109945278 CTGCATCCTCACATGGTGGAAGG + Intergenic
1113501539 13:110779355-110779377 CTGTGTGCTCACATGGTGGAAGG + Intergenic
1114731290 14:24995184-24995206 CTGTGTACTCACATGGTAGAAGG + Intronic
1114739688 14:25082607-25082629 CTGTAACCTCACATGGCAGAAGG - Intergenic
1114836596 14:26210361-26210383 CTGCATCTTTACATGGTGGAAGG - Intergenic
1115863649 14:37717972-37717994 CTGTGTCCTCACATGGTGGAAGG - Intronic
1116114271 14:40628502-40628524 CTCTAACCTCACATGGTGGAAGG - Intergenic
1116528820 14:45941042-45941064 CTGTGTATTCACATGGTGGAAGG + Intergenic
1117157701 14:52957184-52957206 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1117180399 14:53185496-53185518 CTGTGTACTCACATAGTGGAAGG + Intergenic
1117575696 14:57094954-57094976 CTGCAACCAAACATGGTGGAAGG + Intergenic
1117679208 14:58185839-58185861 CTGCAACCTCACATGGTGGAAGG - Intronic
1118029329 14:61804964-61804986 CTGTCACCTCACACGGTGGAAGG - Intergenic
1118407943 14:65445293-65445315 CTGTAAACACTCATGGTGAAAGG - Intronic
1118429860 14:65706647-65706669 CTGTATCCTCACATGGTAGAAGG + Intronic
1118878451 14:69805023-69805045 CTGTGCCCTTAGATGGTGGAGGG - Intergenic
1118890872 14:69907861-69907883 CTCTAATCTTACATGGCAGAAGG + Intronic
1119547653 14:75484122-75484144 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1119911468 14:78353432-78353454 CTGTGTCCTCACATGGTGGAAGG + Intronic
1120055924 14:79924036-79924058 CTGTGCCCTTACATGATGGAGGG + Intergenic
1120155186 14:81085541-81085563 CTGGCAACTTACATGGAGGCTGG - Intronic
1120322620 14:82984365-82984387 CTGTGTCCTTACATGGTGGAGGG + Intergenic
1120713676 14:87818168-87818190 CTGTATTCTCACATGATGGATGG - Intergenic
1120845419 14:89120966-89120988 CTGTGTCCTTACATGGTAGAAGG + Intergenic
1120920310 14:89749052-89749074 CTGGACACTTACACGGTGGCTGG + Intergenic
1121069919 14:91009279-91009301 CTGTGTCCTCACATGGTGGAAGG - Intronic
1121164374 14:91777774-91777796 CTGTAACCTTAGCTGGTAGAAGG + Intronic
1121297929 14:92844999-92845021 CTGTAACCTTACATGGCAGAAGG + Intergenic
1121300649 14:92867971-92867993 CTGTATCCTCACATGTTGGAAGG + Intergenic
1121396434 14:93627706-93627728 CTTTAAAGTCACATGGTGAAAGG + Intronic
1121427303 14:93861625-93861647 CTGTGTTCTCACATGGTGGAGGG - Intergenic
1121884700 14:97532812-97532834 CTGTGTCCTTACATGGTAGAAGG + Intergenic
1121974732 14:98392374-98392396 CTGTGTCCTTACATGGTGGATGG - Intergenic
1122495843 14:102154365-102154387 CTGTGTCCTCACATGGTGGAGGG + Intronic
1202894408 14_KI270722v1_random:190336-190358 CTGCATCCTTACATGGTGGAAGG + Intergenic
1124046789 15:26157883-26157905 TTGTATCCTCACATGGTGGAGGG + Intergenic
1124245041 15:28061615-28061637 CTGTGTACTCACCTGGTGGAAGG - Intronic
1124395954 15:29301833-29301855 CTGTGTCCTCACATGGTGGAAGG - Intronic
1124628040 15:31320847-31320869 CTATAACCTCACATGGTGGAAGG + Intergenic
1124800062 15:32823878-32823900 CTGCGAACTCACAAGGTGGAAGG + Intronic
1125001012 15:34769939-34769961 ATGGAAAATTACATGCTGGAAGG - Intergenic
1125134551 15:36326770-36326792 CAGCAAAATAACATGGTGGAAGG - Intergenic
1125370042 15:38965596-38965618 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1126124149 15:45280081-45280103 CTGTAACCTCACATGGCAGAAGG - Intergenic
1126243997 15:46481955-46481977 CTGTATCATCACATGGTGGAAGG - Intergenic
1126358742 15:47823591-47823613 CTGAGACCTCACATGGTGGAAGG - Intergenic
1126361509 15:47851171-47851193 ATATAAACTTAGATAGTGGATGG + Intergenic
1126541163 15:49825574-49825596 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1127093824 15:55493109-55493131 CTGTGTCCTCACATGGTGGAAGG - Intronic
1127783777 15:62338679-62338701 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1128060671 15:64733689-64733711 CTGTAAAATTAGATGATTGATGG + Intergenic
1128405470 15:67333051-67333073 CTGTGTCCTCACATGGTGGAGGG + Intronic
1128507687 15:68287772-68287794 CTGTGTCCTCACATGGTGGAAGG + Intronic
1128912324 15:71527130-71527152 CTGTGTCCTTACATGGTGAAAGG - Intronic
1129063220 15:72878262-72878284 CTGTATCCTCACATGGAGGAAGG + Intergenic
1129589553 15:76903515-76903537 CTGTCTCCTTACATGGTGCAAGG - Intronic
1130050113 15:80477343-80477365 CTGTGTCCTCACATGGTGGAAGG + Intronic
1130685544 15:86033893-86033915 CTGCATTCTCACATGGTGGAAGG + Intergenic
1131583667 15:93671015-93671037 ATGAAAACTTGCAAGGTGGACGG - Intergenic
1132129363 15:99261506-99261528 CTGTATTCTCACATGGTGGAAGG + Intronic
1132248006 15:100312126-100312148 ATGTGAACTTACATGGTAAACGG + Intronic
1133830223 16:9316210-9316232 CTGTGCCCTTACATGATGGAAGG + Intergenic
1134832382 16:17334038-17334060 CTGTGACCTCACATGGTGAAAGG - Intronic
1135985493 16:27180832-27180854 CTATGTTCTTACATGGTGGAAGG - Intergenic
1135996612 16:27254490-27254512 CTGTAAGCTTTCATGTTGGTGGG - Intronic
1136022398 16:27448597-27448619 CTGTACACCTCCAGGGTGGAGGG - Exonic
1136678246 16:31935420-31935442 CTGTGTTCTTAAATGGTGGAAGG - Intergenic
1137406689 16:48194685-48194707 TTGTATCCTTACATGGTGAAAGG - Intronic
1138215770 16:55204010-55204032 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1138317489 16:56082680-56082702 CTGCATCCTTACATGGTGGAAGG + Intergenic
1138730001 16:59184098-59184120 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1139314526 16:66056928-66056950 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1140694027 16:77514076-77514098 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1140721450 16:77775902-77775924 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1141269777 16:82528575-82528597 CTGTAAAGTTACATGGCCAAGGG + Intergenic
1141417106 16:83884135-83884157 CTGTGTCCCTACATGGTGGAAGG - Intergenic
1141676433 16:85520195-85520217 CTGTATCCTCACATGGTGAAAGG + Intergenic
1143316893 17:6039719-6039741 CTGTGCCCTCACATGGTGGAAGG + Intronic
1144146124 17:12399431-12399453 CTGCAACCTCACATGGTGGAAGG - Intergenic
1144147932 17:12416182-12416204 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1144287299 17:13789315-13789337 TTATAGCCTTACATGGTGGAAGG - Intergenic
1145837525 17:27965856-27965878 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1146296315 17:31653400-31653422 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1146303104 17:31706634-31706656 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1146309583 17:31756929-31756951 CTGTGTCCCTACATGGTGGAAGG - Intergenic
1146366752 17:32234858-32234880 CTGTGTCCTTACATGGTAGAAGG + Intronic
1146625535 17:34432272-34432294 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1150511104 17:65754068-65754090 TTGAAAAGTTACATGGTGCAAGG + Intronic
1150950251 17:69795466-69795488 CTGTGTCCTTACATGGTGAAAGG - Intergenic
1151268527 17:72975502-72975524 CTGTGTCCTTACATGGCGGAAGG - Intronic
1151973059 17:77468947-77468969 CTGTTCACTTAGATGGGGGATGG + Intronic
1153100914 18:1468599-1468621 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1153426387 18:4969435-4969457 CTGTGACCTCACATGGTGGAAGG - Intergenic
1153464335 18:5372228-5372250 CTGTAGGCTCACAGGGTGGAAGG - Intergenic
1154059804 18:11048501-11048523 TTGTCTACTTACATGTTGGAAGG + Intronic
1154331533 18:13433116-13433138 ATGTAAACTTACATTGTTTATGG + Intronic
1154459739 18:14569352-14569374 CTGTAATCTAACATTGTGGGAGG - Intergenic
1154957544 18:21274174-21274196 CTGTATCCTCACATGGTAGAGGG + Intronic
1155776237 18:29765561-29765583 TTGTATCCTCACATGGTGGAAGG + Intergenic
1155852945 18:30795126-30795148 TTGTAAAATTACATGGAAGAAGG + Intergenic
1156525748 18:37765836-37765858 CTGTAACCTCACATGGCTGAAGG + Intergenic
1156527641 18:37782024-37782046 CTGTATTATAACATGGTGGAAGG + Intergenic
1156612979 18:38749612-38749634 CTGTATCCTCACATGGTGGAAGG + Intergenic
1157281523 18:46349332-46349354 CTGTAACCTTGCATGGCAGATGG + Intronic
1157533021 18:48438323-48438345 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1157626966 18:49059191-49059213 CTGTGTCCTTACATGGTGGACGG - Intronic
1158162308 18:54499120-54499142 ATGTGTCCTTACATGGTGGAAGG + Intergenic
1158245485 18:55427700-55427722 CTGTAAACTTTCATTGTAGGTGG - Intronic
1158390649 18:57042246-57042268 CTGTGGCCTCACATGGTGGAAGG + Intergenic
1158511070 18:58091114-58091136 CTCTCAGCTTGCATGGTGGAAGG - Intronic
1158513606 18:58112981-58113003 CTGTATCCTCACATGGTAGAAGG - Intronic
1158620400 18:59027858-59027880 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1158645840 18:59246311-59246333 CTGCATCCTCACATGGTGGAAGG + Intergenic
1158860402 18:61586239-61586261 CTGTGTACTCACGTGGTGGAAGG + Intergenic
1159013871 18:63085450-63085472 CTGGAAACTTGCATGCTGCATGG - Intergenic
1159270379 18:66141563-66141585 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1159463897 18:68754865-68754887 CTGCATGCTCACATGGTGGAAGG - Intronic
1159695989 18:71556897-71556919 CTATTAACTAACTTGGTGGAAGG - Intergenic
1159712144 18:71774059-71774081 CTGGAAACTAAAATGGGGGAGGG - Intronic
1163320937 19:16574271-16574293 CTGTAGTCTTACAGGCTGGAAGG + Intronic
1164946686 19:32300400-32300422 CTGTAACTTCACATGGAGGAAGG - Intergenic
1165819013 19:38662708-38662730 CTGTAAGTTTCCATGGTGGGTGG + Intronic
1168580634 19:57553056-57553078 CTGTGTTCTTACAAGGTGGAGGG - Intronic
925016879 2:534697-534719 CTGTGTTCTCACATGGTGGAAGG + Intergenic
925214135 2:2079001-2079023 CTGCATCCTTACATGGTGGAAGG - Intronic
925483364 2:4301416-4301438 CTGTGTCCTCACATGGTGGAAGG - Intergenic
925664854 2:6241911-6241933 CTGTAATCTTGCATGGCTGAAGG + Intergenic
926288503 2:11509734-11509756 CTGCATCCTCACATGGTGGAAGG - Intergenic
926452892 2:13027307-13027329 CTGTGTCCTCACATGGTGGAAGG + Intergenic
926732465 2:16046815-16046837 ATGTATACTTACATGGTGAAAGG - Intergenic
926908396 2:17827134-17827156 CTGTGTCCTTACATGGTGGAAGG + Intergenic
926961867 2:18365819-18365841 CTGCATCCTCACATGGTGGAGGG - Intergenic
927121801 2:19971441-19971463 CTGCATAATTTCATGGTGGAAGG - Intronic
927311310 2:21634825-21634847 CTGTGTCCTCACATGGTGGAAGG - Intergenic
927431861 2:23033292-23033314 CTGTGTCCTTACATGGGGGAAGG + Intergenic
927458041 2:23274478-23274500 CTGCATCCTCACATGGTGGAAGG - Intergenic
928101637 2:28440768-28440790 CTGCAAACCTGCTTGGTGGAGGG - Intergenic
928257163 2:29732740-29732762 CTGTGTCCTCACATGGTGGAAGG - Intronic
928280712 2:29943865-29943887 CTGTAACCTTACCTGGCAGAAGG - Intergenic
928471931 2:31583387-31583409 TTGTAAAGTTACATGGTAAAGGG + Intergenic
928694017 2:33830421-33830443 CTGTGTCCTCACATGGTGGAAGG - Intergenic
928991620 2:37238029-37238051 CTGTAAACTTAAAAATTGGAGGG + Intronic
929058664 2:37901085-37901107 CTGTAACCTTATATGGCAGAAGG + Intergenic
929072017 2:38040451-38040473 CTGTGTCCTTACATGATGGAAGG - Intronic
929129038 2:38547969-38547991 CTGTAACCTCACATGGCAGAAGG - Intergenic
929228114 2:39531623-39531645 CTGTGTCCTCACATGGTGGAAGG + Intergenic
929985833 2:46731289-46731311 CTGTAACCTCACATGGTGGAAGG - Intronic
930107175 2:47649474-47649496 CTGTGTCCTCACATGGTGGAGGG - Intergenic
930170638 2:48247723-48247745 CTGTTTCCTCACATGGTGGAAGG - Intergenic
930602687 2:53459968-53459990 TTGTAACGTTACATGGTAGAAGG - Intergenic
930605948 2:53493179-53493201 CTGTAAACTCACATGGGAGAAGG - Intergenic
930689155 2:54341343-54341365 CTGCATCCTCACATGGTGGAAGG - Intronic
930851748 2:55968477-55968499 CTGTGTCCTCACATGGTGGAGGG - Intergenic
931140586 2:59453248-59453270 CTGCATCTTTACATGGTGGAAGG - Intergenic
931627649 2:64271275-64271297 TTGTAATCTCACATGGTGAAAGG - Intergenic
931752971 2:65347090-65347112 CTGCAAACTTACGAGGTGGTCGG - Intronic
931987263 2:67754080-67754102 CTGTAACCTCACATAGTGGAAGG - Intergenic
932376080 2:71237162-71237184 ATGTTAACTTACATGGTAAAAGG - Intergenic
932784741 2:74590268-74590290 CTGTATCCTCATATGGTGGAGGG + Intronic
932855717 2:75232201-75232223 CTGTGTCCTTGCATGGTGGAAGG + Intergenic
933056932 2:77682246-77682268 CTGCACACTTACATGGTGAAAGG + Intergenic
933133887 2:78707359-78707381 CTGTGTCCTCACATGGTGGAGGG + Intergenic
933490081 2:82974886-82974908 TTGTAAGCTCACATGGTGGAAGG + Intergenic
933850530 2:86362940-86362962 CTGCATTCTCACATGGTGGAAGG - Intergenic
933927061 2:87103390-87103412 CTGCACACTTACATGGTGAAAGG + Intergenic
933982398 2:87562410-87562432 CTGTGTCCTCACATGGTGGAGGG + Intergenic
933993757 2:87652460-87652482 CTGTATCATTACACGGTGGAAGG + Intergenic
934694303 2:96387940-96387962 CTGCGACCTCACATGGTGGAAGG - Intergenic
935586975 2:104809462-104809484 CTGCATTCTTACATGGTGGAAGG - Intergenic
935745229 2:106184599-106184621 CTGTATCCTCACATGGTGGAAGG + Intronic
935936139 2:108185132-108185154 CTGTAACCTCACATGGCAGAAGG + Intergenic
936300106 2:111298423-111298445 CTGTATCATTACACGGTGGAAGG - Intergenic
936628743 2:114177187-114177209 ACCTAAACTTACACGGTGGAAGG + Intergenic
936785036 2:116084605-116084627 CTGTATTCTCCCATGGTGGAGGG - Intergenic
937029725 2:118728391-118728413 CTGTACCCTCACATGGTGGAAGG - Intergenic
937088620 2:119189621-119189643 CTGTGTCCTCACATGGTGGAGGG - Intergenic
937433884 2:121864154-121864176 CTGTATCCTCACATGGTGGAAGG - Intergenic
937626480 2:124049898-124049920 CTGTAATCTCACATGGTGGAGGG + Intronic
938116371 2:128605474-128605496 GTGCATACTTACTTGGTGGATGG + Intergenic
938556852 2:132432270-132432292 CTGTGTCCTCACATGGTGGAAGG + Intronic
939252557 2:139700870-139700892 CTACATGCTTACATGGTGGAAGG + Intergenic
939269266 2:139916692-139916714 CTGTATCTTCACATGGTGGAAGG - Intergenic
940372777 2:152921401-152921423 CTGCAACCTCACATGGTAGAAGG + Intergenic
940672982 2:156693637-156693659 CTGTGCTCTCACATGGTGGAGGG - Intergenic
940722104 2:157293322-157293344 CTGTGACCTTACATGGTGGAAGG + Intronic
940771617 2:157844869-157844891 CTGTGTTCTCACATGGTGGAAGG - Intronic
941226095 2:162849850-162849872 CTGTATTCTGACATGGTGGAAGG - Intergenic
941349858 2:164418768-164418790 CTGTATCCTCACATGGTGGAAGG + Intergenic
941709439 2:168696681-168696703 CTGTGTCCTCACATGGTGGAAGG + Intronic
941835986 2:170021440-170021462 CTGTAACCTCACGTGGTGGAAGG + Intronic
942427954 2:175879189-175879211 CTGCAAATTGACATGGTGCAGGG - Intergenic
942489624 2:176476399-176476421 CTGTAACCTCACATGGCAGAAGG - Intergenic
942513083 2:176723282-176723304 CTGTGACCTCATATGGTGGAAGG - Intergenic
942555936 2:177172310-177172332 CTGTACCCTTACATGGGGGCTGG - Intergenic
942718243 2:178919082-178919104 CTGTATCCTCACATGGTGGAAGG - Intronic
942996930 2:182274053-182274075 CTGTAACCTCACATGGTAGAAGG + Intronic
943101954 2:183497662-183497684 CTGTGAGCTCACATGGTAGAAGG - Intergenic
943195627 2:184744485-184744507 CTGTGTCCTCACATGGTGGAAGG - Intronic
943379614 2:187127910-187127932 CTCTGTCCTTACATGGTGGATGG - Intergenic
943763892 2:191639475-191639497 CTGGAATCATACATGGAGGATGG + Intergenic
944029209 2:195213411-195213433 CTGTGTCCTTACATAGTGGAAGG - Intergenic
944167085 2:196734514-196734536 CTGTGTCCTCACATGGTGGAAGG - Intronic
944653087 2:201851450-201851472 CTGTGTCCTTACATGGTGGAAGG + Intronic
944850103 2:203710333-203710355 CTGTAAACGTCCTTGCTGGATGG - Intronic
944886401 2:204066750-204066772 TTGTAAACTCACATGGTTGTTGG - Intergenic
944965489 2:204927354-204927376 CTGCACCCTTGCATGGTGGAAGG - Intronic
945065324 2:205943331-205943353 CTGAAAAGTTACAAGGTGCAGGG + Intergenic
945455339 2:210046067-210046089 CTGTAACCTCAAATGATGGAAGG + Intronic
946113258 2:217438504-217438526 CTGTGTCCTCACATGGTGGAAGG - Intronic
946331533 2:219012018-219012040 CTGTGTCCTCACATGGTGGAGGG - Intronic
946481469 2:220060749-220060771 CTTTGTGCTTACATGGTGGAAGG - Intergenic
946972348 2:225108558-225108580 CTGTGTCCTCACATGGTGGAAGG + Intergenic
947154807 2:227151790-227151812 CTGCATCCTCACATGGTGGAAGG - Intronic
947261110 2:228223501-228223523 CTGTAACCTAACATGGCAGAAGG - Intergenic
947361791 2:229352854-229352876 CTGTGTCCTCACATGGTGGAAGG - Intergenic
947385951 2:229590656-229590678 CTGTAACCTCACATGGTAGAAGG - Intronic
947814594 2:233027881-233027903 CTGTGTCCTCACATGGTGGAGGG + Intergenic
948286846 2:236792805-236792827 TTGTGTACTTACATGGTGGATGG + Intergenic
948360652 2:237417750-237417772 CTGTATCCTCACATGGTGGGAGG - Intergenic
948512470 2:238477948-238477970 CTGTGTCCTCACATGGTGGAAGG - Intergenic
948522903 2:238552243-238552265 CTGTGTCCTCACATGGTGGAAGG - Intergenic
948582950 2:239000326-239000348 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1169594574 20:7183280-7183302 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1169606274 20:7323128-7323150 CTGTATCCTCACATGGTGGAGGG + Intergenic
1169752341 20:9007118-9007140 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1169837933 20:9901189-9901211 CTGTATCTTCACATGGTGGAAGG + Intergenic
1170053215 20:12170172-12170194 CTGAAAAAGTACATGATGGAGGG - Intergenic
1170796934 20:19556045-19556067 CTGTGTCCTCACATGGTGGAAGG + Intronic
1171726253 20:28623884-28623906 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1171751879 20:29059491-29059513 CTGTTTCCTCACATGGTGGAAGG - Intergenic
1171790447 20:29518379-29518401 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1171815507 20:29782895-29782917 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1171857265 20:30358456-30358478 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1172168399 20:32913308-32913330 CTGTAAACTTACATGGTGGAAGG + Intronic
1172352198 20:34251808-34251830 CTCTAATCTCACAAGGTGGAAGG - Intronic
1172585559 20:36081350-36081372 CGGTGACCTCACATGGTGGAAGG + Intergenic
1172784340 20:37456726-37456748 CTGTGTCCTTACATGGTGCAAGG + Intergenic
1172890752 20:38262093-38262115 CTGTGTCCTTCCATGGTGGAAGG - Intronic
1173148148 20:40543227-40543249 CTGTGACCTCATATGGTGGAAGG - Intergenic
1173180571 20:40803617-40803639 CTGTGTCCTGACATGGTGGAAGG + Intergenic
1173291510 20:41719072-41719094 CTGTGCCCTCACATGGTGGAAGG + Intergenic
1173574586 20:44103943-44103965 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1174169131 20:48605373-48605395 CTTTAAAGTTCCATAGTGGAAGG + Intergenic
1175255266 20:57641156-57641178 CTGGGAACTCATATGGTGGAAGG - Intergenic
1175434255 20:58931534-58931556 CTGTATCTGTACATGGTGGAAGG - Intergenic
1175552380 20:59825946-59825968 CTGTGTCCTCACATGGTGGAGGG - Intronic
1175596497 20:60238936-60238958 CTGTAACCTCACATGGTGGCAGG - Intergenic
1175630971 20:60536140-60536162 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1176937274 21:14881980-14882002 CTGTATACTCACATGGTGGAAGG + Intergenic
1177190948 21:17850352-17850374 CTGTTTTCTCACATGGTGGAAGG + Intergenic
1177301979 21:19258802-19258824 CTGTAACCTCACATGGCAGAAGG + Intergenic
1177535302 21:22419542-22419564 CTGTATTCTCACATGGTGGAAGG - Intergenic
1177582173 21:23038775-23038797 CTTAAAACTTATATGGTGTATGG - Intergenic
1177898524 21:26884250-26884272 TTGTAACCTCACATGGTGAAAGG - Intergenic
1177959576 21:27645903-27645925 CTATATCCTTACATGGGGGAAGG - Intergenic
1178097013 21:29226793-29226815 CTGTGTCCTCACATGGTGGAAGG + Intronic
1178305140 21:31484941-31484963 CTGAGTCCTTACATGGTGGAAGG - Intronic
1178462337 21:32814378-32814400 CTGAGTCCTTACATGGTGGAAGG + Intergenic
1179382839 21:40915320-40915342 CTGCAAACTCACATGGAGGGTGG - Intergenic
1180318953 22:11303461-11303483 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1180336263 22:11579113-11579135 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1180408589 22:12581249-12581271 CTGTTTCCTCACATGGTGGAAGG - Intergenic
1180947879 22:19706744-19706766 CTATAATTTCACATGGTGGAAGG - Intergenic
1181341681 22:22185821-22185843 CTGCGAGCTCACATGGTGGAAGG - Intergenic
1182259164 22:29060555-29060577 CTCCAAACTTGCATGGTGGTGGG + Exonic
1182483485 22:30625344-30625366 CTGTGTTCTCACATGGTGGAAGG + Intronic
1182741184 22:32568584-32568606 CTGTAACCTCACAGGATGGAAGG + Intronic
1182931144 22:34175482-34175504 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1183012392 22:34957583-34957605 CTGTAACCTCACATGGCAGAAGG + Intergenic
1183017800 22:35004245-35004267 CTGCATCCTTACATGGTGAAAGG + Intergenic
1183337988 22:37261648-37261670 CTGTATCCTCACGTGGTGGAGGG - Intergenic
1183870859 22:40741116-40741138 CTGTAATCTCACATGCTGGAAGG - Intergenic
1184290214 22:43494902-43494924 CTGTTTCCTTACATAGTGGAAGG + Intronic
1185005075 22:48271056-48271078 CTGTGTCCTCACATGGTGGAAGG + Intergenic
949319616 3:2794849-2794871 CTGTGCACTCACGTGGTGGAAGG + Intronic
949372717 3:3352957-3352979 CTGTGTCCTCACATGGTGGAAGG - Intergenic
949661115 3:6279876-6279898 CTGTTTCCTTACATGGTGGATGG - Intergenic
949695341 3:6688251-6688273 CCGTGAACTTACATGGGAGAAGG + Intergenic
949957077 3:9277967-9277989 CTGTGTCCTCACATGGTGGAAGG - Intronic
950167195 3:10810372-10810394 CTGCAAAGTTACATGGCAGATGG + Intergenic
950896633 3:16457950-16457972 CTGTGTCCTCACATGGTGGAAGG - Intronic
950912708 3:16611563-16611585 CTGTATTCTTACATGGTAGAAGG - Intronic
950948769 3:16977903-16977925 CTGCATCCTCACATGGTGGAAGG + Intronic
950978491 3:17276195-17276217 CTGTTTCCTTACGTGGTGGAAGG + Intronic
951051032 3:18093766-18093788 CTGCATCCTTACATGGTGGAAGG + Intronic
951347462 3:21563199-21563221 CTGTATTTTCACATGGTGGAAGG - Intronic
951706613 3:25550458-25550480 CTGTAACCTCACATGGCAGAAGG + Intronic
951753177 3:26059862-26059884 CTGTGTCTTTACATGGTGGAAGG + Intergenic
952434323 3:33257114-33257136 CTGTGTCCTCACATGGTGGAAGG - Intergenic
952496387 3:33919510-33919532 CTGGAAACTTCCACAGTGGAAGG - Intergenic
952509820 3:34041834-34041856 CTGTGTCCTCACATGGTGGAAGG - Intergenic
952775121 3:37038403-37038425 CTGTATCCTTACATAGTGGAAGG + Intronic
953536680 3:43782368-43782390 CTGTAAACTTACTTACAGGAGGG + Intergenic
953545390 3:43860572-43860594 CTGGAAACTGACCTGGTGGTGGG + Intergenic
955123160 3:56082309-56082331 CTGTGTTCTCACATGGTGGAAGG - Intronic
955515649 3:59724026-59724048 CTGTGTCCTCACATGGTGGAAGG + Intergenic
955525944 3:59819919-59819941 CTGTGTCCTCACATGGTGGAAGG - Intronic
955541440 3:59980692-59980714 CTGTGTCCTCACATGGTGGAAGG - Intronic
956735590 3:72235550-72235572 CTGCACCCTCACATGGTGGAAGG + Intergenic
957167281 3:76691249-76691271 CTGTGATGTAACATGGTGGAAGG - Intronic
957285115 3:78207839-78207861 TTGTATCCTCACATGGTGGAAGG - Intergenic
957628245 3:82682777-82682799 CTGTAAACTTTCTGTGTGGATGG + Intergenic
957688309 3:83533710-83533732 CTGCATCCTTACAAGGTGGAAGG - Intergenic
957791057 3:84941851-84941873 CTGTGTCCTCACATGGTGGAAGG + Intergenic
958411703 3:93825195-93825217 CTGTGTCCTCACATGGTGGAAGG + Intergenic
958484771 3:94690793-94690815 CTGTGTCCTTTCATGGTGGAAGG + Intergenic
958751856 3:98201305-98201327 CTGTATCCTTACATGGTTGAAGG + Intergenic
958836023 3:99146024-99146046 CTGTGTCCTCACATGGTGGAAGG - Intergenic
959003227 3:100989147-100989169 CTGCATCCTCACATGGTGGAAGG - Intronic
959517532 3:107286131-107286153 CTGCATCCTTACATGGTAGAAGG - Intergenic
959518425 3:107297860-107297882 CTGTATCCTCACATGATGGAAGG - Intergenic
959760876 3:109963418-109963440 CTATATCCTTATATGGTGGAAGG + Intergenic
959770190 3:110085671-110085693 CTGTGTCCTCACATGGTGGAAGG - Intergenic
959798534 3:110462287-110462309 CTGCATTCTGACATGGTGGAAGG + Intergenic
959910599 3:111759311-111759333 CTGTGTCCTCACATGGTGGAAGG + Intronic
960121594 3:113952805-113952827 CTGTGTCCTCACATGGTGGAAGG + Intronic
960260108 3:115557658-115557680 CTGTGACCTCACATAGTGGAAGG + Intergenic
960461588 3:117942525-117942547 CTGTATCCTCACATGGTGGATGG - Intergenic
961184550 3:124903163-124903185 CTGTAACCTCGCATGTTGGAAGG - Intergenic
961251802 3:125513217-125513239 CTGTGTCCTCACATGGTGGAAGG - Intronic
961990000 3:131179124-131179146 CTGTGTCCTCACATGGTGGAAGG - Intronic
962301237 3:134244925-134244947 CTGTGTTCTCACATGGTGGAAGG - Intronic
962451987 3:135527476-135527498 CTGTAACCTTACATGGTGGAAGG - Intergenic
962685451 3:137843214-137843236 CTACATCCTTACATGGTGGAAGG - Intergenic
962948290 3:140194276-140194298 CTGTGTCCTTACATGGTGGAAGG + Intronic
963071660 3:141309894-141309916 CTGTGTCCTCACATGGTGGAAGG - Intergenic
963262639 3:143208206-143208228 CTGTGTCCTCACATGGTGGAAGG + Intergenic
963645471 3:147908376-147908398 CTGTGTTCTCACATGGTGGAAGG - Intergenic
963731552 3:148978889-148978911 CTGTCTTCTTCCATGGTGGAAGG - Intergenic
963958887 3:151285831-151285853 CTGTGTCCTTACATGGCGGAAGG - Intronic
963989363 3:151635413-151635435 CTGTGTCCTCACATGGTGGAAGG + Intergenic
964020045 3:151999122-151999144 ATGTTACCTTACATGGTGAAGGG + Intergenic
964240054 3:154582061-154582083 CTGTGTACATACATGGTTGAAGG + Intergenic
964838469 3:160967478-160967500 CTGTAACCTTACATGGCAGGAGG + Intronic
964885140 3:161473363-161473385 CTGTGTACTCACATGGTGGAAGG + Intergenic
965115331 3:164481128-164481150 CTGCATCCTTACATGGTGGAGGG - Intergenic
965443457 3:168745607-168745629 CTGTGTCCTCACATGGTGGAAGG + Intergenic
965759869 3:172064189-172064211 CTGTGTCCTCACATGGTGGAGGG - Intronic
965968294 3:174523004-174523026 CTGTGTCCTCACATGGTGGAAGG - Intronic
966003834 3:174983598-174983620 CTGTGTCCTCACATGGTGGAAGG + Intronic
966239728 3:177743114-177743136 GTGTGTCCTTACATGGTGGAAGG + Intergenic
966426815 3:179788747-179788769 CTCTAGACTTACATGGTGTGGGG + Exonic
966693825 3:182768912-182768934 CTGCATCCTTACGTGGTGGAAGG + Intergenic
966911716 3:184563477-184563499 CGGTAAACTTAAAGGTTGGAAGG + Intronic
966937374 3:184719834-184719856 CTGTTAACTTACCTGCTGGAAGG + Intergenic
968946471 4:3667105-3667127 CTGCAAAGTCACATGGTGAATGG - Intergenic
970800091 4:19963067-19963089 CTGCATCCTCACATGGTGGAGGG + Intergenic
970932007 4:21523085-21523107 CTGTAACCTAACATGGTGGAAGG - Intronic
970968812 4:21957777-21957799 CTGTGTCCTTACATGGTAGAAGG - Intergenic
971324641 4:25633985-25634007 CTGTATCCTCACATGGTGGAAGG + Intergenic
971353885 4:25877050-25877072 CTGTGTCCTCACATGGTGGAAGG - Intronic
971361957 4:25946398-25946420 CTGCACCCTCACATGGTGGAAGG + Intergenic
971485809 4:27159001-27159023 CTATATCCTTACATGGTGGAGGG - Intergenic
971842413 4:31871134-31871156 CTGTATTCTTACATGGCAGAAGG - Intergenic
972008321 4:34140666-34140688 CTATAAAAATACATGGTGTAAGG + Intergenic
972110760 4:35556036-35556058 CTGTATCTTTACATGATGGAAGG - Intergenic
972175224 4:36396586-36396608 CTGTAACCTCACATGTTGGAAGG + Intergenic
972226149 4:37015134-37015156 CTATACCCTCACATGGTGGAAGG - Intergenic
972226265 4:37016435-37016457 CTGTGTACTCACATAGTGGAAGG - Intergenic
972297133 4:37750634-37750656 CTGTGTCCTCACATGGTGGAAGG - Intergenic
972425310 4:38927390-38927412 CTGTGTCCTTACATGGTGGAAGG + Intronic
972842374 4:42946654-42946676 CTGTATCCTCACATGGTGAAAGG + Intronic
972990449 4:44817199-44817221 CTGTGTCCTCACATGGTGGAAGG + Intergenic
973152095 4:46900741-46900763 CTGTATTCTCACATGGTGGTAGG - Intronic
973185814 4:47326667-47326689 CTGTGTCCTTATATGGTGGAAGG - Intronic
973802001 4:54487430-54487452 CTGTGAACTTACATGGTGGAAGG - Intergenic
974439673 4:61899816-61899838 CTGAATCCTCACATGGTGGAAGG + Intronic
974610598 4:64210401-64210423 CTGTGTGCTCACATGGTGGAAGG - Intergenic
974835684 4:67247482-67247504 CTGTGTCCTTTCATGGTGGAAGG - Intergenic
974904982 4:68044493-68044515 CTGTATCCTCACATGGTGGATGG - Intergenic
975241582 4:72066190-72066212 CTGTGTCCTTACAAGGTGGAAGG + Intronic
975921758 4:79398911-79398933 CTGTGACGTTGCATGGTGGAAGG - Intergenic
976133532 4:81910466-81910488 CTGTAAACATTCCTGTTGGATGG - Intronic
976593674 4:86874369-86874391 CTGTGTCTTTACATGGTGGAAGG - Intergenic
976664116 4:87571924-87571946 CTGTATTCTAACGTGGTGGAAGG + Intergenic
976764498 4:88585099-88585121 CTGTGTCCTCACATGGTGGAAGG + Intronic
977421314 4:96803325-96803347 CTGTAACCTCACATGGCAGAAGG - Intergenic
977589155 4:98807436-98807458 CTGAATCCTTACATGGTGGAAGG - Intergenic
977695095 4:99956239-99956261 CTGTGTCCTTACATTGTGGAAGG + Intergenic
977807205 4:101315175-101315197 TTGTAACTTCACATGGTGGAAGG - Intronic
978285025 4:107066883-107066905 CTGTGTCCTCACATGGTGGAAGG - Intronic
978696567 4:111587184-111587206 CTGTGTCCTCACATGGTGGAAGG + Intergenic
979006383 4:115303145-115303167 CTGTATCCTTACATGATAGAAGG - Intergenic
979021224 4:115501050-115501072 CTGTATCCTCACATGGTGGAAGG - Intergenic
979665777 4:123309358-123309380 CTGTGTCCTCACATGGTGGAAGG + Intronic
979714600 4:123822581-123822603 CTGTGCCCTCACATGGTGGACGG + Intergenic
979719622 4:123883428-123883450 CTGGGTTCTTACATGGTGGAAGG - Intergenic
979727090 4:123975052-123975074 CTGTGTCCTCACATGGTGGAAGG - Intergenic
980174848 4:129332209-129332231 CTGTAACCTCACATGGCAGAAGG - Intergenic
980429211 4:132668305-132668327 CTGTATCCTCACATGGTGGAAGG + Intergenic
980452420 4:132991815-132991837 CTGTATCCTCACATGGTGGAAGG - Intergenic
980727066 4:136776542-136776564 CTGTGTCCTCACATGGTGGAAGG - Intergenic
980976571 4:139616785-139616807 CTGCATCCTCACATGGTGGAAGG + Intergenic
981038740 4:140199914-140199936 CTGTGTTCTCACATGGTGGAAGG + Intergenic
981039568 4:140210819-140210841 CTGTACCCTTACATGATGTAGGG - Intergenic
981417134 4:144506353-144506375 CTATATACTCACATGGTAGAAGG + Intergenic
981506690 4:145508820-145508842 CTGTAACCTCATATGGTGGAAGG + Intronic
981747916 4:148068837-148068859 CTGAAAACTGAGTTGGTGGAAGG + Intronic
981838875 4:149088004-149088026 CTGTATGCTTACATGGTAGGGGG + Intergenic
981971499 4:150667705-150667727 TTGTATCCTAACATGGTGGAAGG - Intronic
982115333 4:152094235-152094257 CTGTGTCCTCACATGGTGGACGG - Intergenic
982163202 4:152590641-152590663 CTGTAAAGTTAATTGGTGAATGG - Intergenic
982165296 4:152608518-152608540 CTGTGTCCTTATATGGTGGAAGG - Intergenic
982203753 4:152981797-152981819 CTGTGTCCTCACATGGTGGAAGG - Intergenic
982304472 4:153915789-153915811 CTGTATCCTCACATGGGGGATGG - Intergenic
982453848 4:155584661-155584683 CTGTATCCTCTCATGGTGGAAGG + Intergenic
982486213 4:155968668-155968690 CAGAAAACTTTCATAGTGGAAGG - Intergenic
982627000 4:157780057-157780079 CAGGAAACTTTCATGGTGGAAGG - Intergenic
982709979 4:158748242-158748264 CTGTGTTCTCACATGGTGGAAGG - Intergenic
982743202 4:159079337-159079359 CTGTGTCCTCACATGGTGGAAGG - Intergenic
982900219 4:160989489-160989511 CTTTAAAATTACATGGAAGAGGG - Intergenic
982980510 4:162128464-162128486 CTATGTACTCACATGGTGGAAGG - Intronic
983031802 4:162811939-162811961 CTGTGTATTCACATGGTGGAAGG + Intergenic
983477064 4:168226425-168226447 CTGTGTTCTCACATGGTGGAAGG - Intronic
983491651 4:168397071-168397093 CTGTGTCCTTACTTGGTGGAAGG - Intronic
983557842 4:169074242-169074264 CTGCATTCTCACATGGTGGAAGG + Intergenic
983795317 4:171854734-171854756 CTGTGTTCTTACATGGTGGAGGG + Intronic
983945150 4:173577859-173577881 CTGTTATCTTCCATAGTGGAAGG + Intergenic
984045731 4:174796187-174796209 CTGTAACCTCACATGGTGGAAGG - Intronic
984183184 4:176510309-176510331 CTGTAAAGTTATATGGTAGAGGG - Intergenic
984435958 4:179710420-179710442 CTGTAACCTCACATGGCAGAAGG + Intergenic
984489026 4:180408838-180408860 CTGTGTTCTCACATGGTGGATGG - Intergenic
984578925 4:181487499-181487521 CTGTGTTCTCACATGGTGGAAGG + Intergenic
985213551 4:187622625-187622647 CTGTATCTTTACATGGTAGAAGG - Intergenic
985434274 4:189913817-189913839 CTGTGTCCTCACATGGTGGAAGG - Intergenic
986203552 5:5601329-5601351 CTGTAATCTCCCATGGTAGAAGG + Intergenic
986225958 5:5812964-5812986 CTGTATTCTCACATGGTGAAGGG - Intergenic
986230850 5:5863755-5863777 CTGTAACCTCACATGATGGAGGG - Intergenic
986447576 5:7836013-7836035 CTGTATCCTCACATGCTGGAAGG + Intronic
986488294 5:8262992-8263014 CTATAAACTTCCATGGTAGACGG + Intergenic
986531622 5:8742715-8742737 CTATATCCTTACATGGTGGAAGG + Intergenic
986670664 5:10140166-10140188 CTGTGTCCTCACATGGTGGAAGG - Intergenic
986867984 5:12012581-12012603 CTGTGCCCTCACATGGTGGAAGG - Intergenic
986945692 5:13016492-13016514 CTGTATCCTCACATGGTGGAAGG + Intergenic
987145841 5:14990724-14990746 CTGTAACCTCACATGGTAGAAGG + Intergenic
987225269 5:15833283-15833305 CTGTGTCCTCACATGGTGGAAGG + Intronic
987241873 5:16008152-16008174 CTGTCAATTTTCATGTTGGAGGG + Intergenic
987302026 5:16605779-16605801 CTGTGTCCTCACATGGTGGAAGG + Intronic
988104152 5:26721954-26721976 CTGTAACCTCACATGGTGGAAGG + Intergenic
988361961 5:30247841-30247863 CTGCACCATTACATGGTGGATGG - Intergenic
988387173 5:30579675-30579697 CTGTGTCCTTACATGGTGGGAGG - Intergenic
988821230 5:34888129-34888151 CTGTAAACTCACATGGTGGAAGG - Intronic
989138722 5:38181406-38181428 CTGCATCCTTACATGGGGGAAGG - Intergenic
989157379 5:38357026-38357048 CTGTGTTCTTACATGGTGAAAGG - Intronic
989289408 5:39745937-39745959 CTGTGTCCTCACATGGTGGAAGG + Intergenic
989980481 5:50637736-50637758 CTGTGTCCTCACATGGTGGAAGG - Intergenic
990111433 5:52330429-52330451 CTGTGTCCTTACATGATGGAAGG + Intergenic
990120235 5:52442359-52442381 CTGTTTCCTCACATGGTGGAAGG - Intergenic
990362236 5:55032234-55032256 CTCTAATCTCACATGGTAGATGG + Intronic
990700167 5:58466505-58466527 CTGTGGTCTCACATGGTGGAAGG - Intergenic
990845220 5:60130044-60130066 CTGTGTCCTCACATGGTGGAAGG - Intronic
991317235 5:65322445-65322467 CTGTAAATTTACATGCAGCATGG + Intronic
991558255 5:67920849-67920871 CTGTGTCCTCACATGGTGGAAGG - Intergenic
991953708 5:71971725-71971747 CTGTATTCTCACATGGGGGAAGG + Intergenic
992200246 5:74376442-74376464 CTGTATTCTCACACGGTGGAGGG - Intergenic
992388037 5:76304701-76304723 CTGTGTCCTCACATGGTGGAAGG + Intronic
992596255 5:78350396-78350418 CTGCATTCTTATATGGTGGAAGG - Intergenic
992747333 5:79832688-79832710 CTGAGTACTCACATGGTGGAGGG + Intergenic
992943481 5:81786401-81786423 CTGTGTCCTCACATGGTGGAAGG + Intergenic
993281706 5:85933455-85933477 CTGTGTCCTCACATGGTGGAAGG - Intergenic
993419688 5:87685320-87685342 CTCTAACCTCACATGGTGGAAGG + Intergenic
994047713 5:95328358-95328380 CTGTGTCCTCACATGGTGGAAGG - Intergenic
994382676 5:99089867-99089889 CAGCAAACTAACATTGTGGATGG + Intergenic
994411651 5:99414138-99414160 CAGTACACTCACATGGAGGAAGG + Intergenic
994482174 5:100351112-100351134 CAGTACACTCACATGGAGGAAGG - Intergenic
994693077 5:103042159-103042181 CAGGAATCTTACATGGTGGGAGG - Intergenic
995058585 5:107789321-107789343 CTGCATCCTCACATGGTGGAAGG - Intergenic
996178303 5:120387367-120387389 CTGTGTCCTCACATGGTGGAAGG + Intergenic
996183190 5:120445831-120445853 CTGTGTCTTTACATGGTGGAAGG - Intergenic
996191948 5:120555487-120555509 CTGTATTCTCACATGGTGGTGGG + Intronic
996214022 5:120845879-120845901 CTGTGTCCTCACATGGTGGAAGG - Intergenic
996235015 5:121116662-121116684 ATGGAAACCTACATGGTAGAGGG - Intergenic
996331271 5:122331680-122331702 CTGTGTCCTCACATGGTGGAAGG + Intronic
996589409 5:125129285-125129307 CTGTGTTCTCACATGGTGGAAGG + Intergenic
997576009 5:134977848-134977870 CAGGAAGCTTACATGGTAGAGGG + Intronic
997720461 5:136074534-136074556 CTGTAGCCTCACTTGGTGGAGGG - Intergenic
997791086 5:136763058-136763080 CTGTGATCTCACCTGGTGGATGG + Intergenic
997849258 5:137316160-137316182 CTGTGTGCTCACATGGTGGAAGG + Intronic
997909393 5:137854970-137854992 CTGTGACCTCACATGGTAGAAGG - Intergenic
999297229 5:150467305-150467327 CTGCATCCTCACATGGTGGAAGG - Intergenic
999364696 5:151014558-151014580 CTGTACCCTCACATGGTAGATGG - Intergenic
999818024 5:155197393-155197415 CCATAACCTCACATGGTGGAAGG - Intergenic
999846614 5:155488388-155488410 CTGTATAATCACATGGTGGAAGG - Intergenic
1000196908 5:158968409-158968431 CTGTGAACTTACAAAGTGGGTGG + Intronic
1000259042 5:159568392-159568414 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1000284083 5:159811528-159811550 CTGTGTGCTCACATGGTGGAAGG - Intergenic
1000423414 5:161062627-161062649 CTGTGACCTCACATGGCGGAAGG - Intergenic
1001446854 5:171792004-171792026 CTGTGTCCTCACATGGTGGAAGG - Intronic
1001477429 5:172060490-172060512 CTGTATCCTCACATAGTGGAAGG - Intronic
1001628396 5:173156304-173156326 CTGTAATGCTACATTGTGGATGG - Intronic
1001630425 5:173170897-173170919 CTGTGTCCTTGCATGGTGGAAGG - Intergenic
1001744247 5:174078748-174078770 CTGTGTCCTCACATGGTGGAAGG - Intronic
1001766725 5:174254718-174254740 CTATTAAGTTACATGCTGGAGGG - Intergenic
1002381843 5:178836300-178836322 CTGTAACCTTGCATGGCAGAAGG + Intergenic
1002625647 5:180526649-180526671 CTTTAAACTTACATGGTCATAGG + Intronic
1003253743 6:4456591-4456613 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1003486745 6:6586734-6586756 CTGTGCCCTCACATGGTGGAAGG - Intergenic
1003877037 6:10447073-10447095 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1004190652 6:13460891-13460913 CTGTGTCCTCACATGGTGGAAGG - Intronic
1005762429 6:28979780-28979802 CTGGAAACTTGCATGGGGGAAGG + Intergenic
1007234688 6:40382136-40382158 CTCTATTCTTACATGGCGGATGG + Intergenic
1007470345 6:42086011-42086033 CTGTGTCCTCACATGGTGGAAGG - Intronic
1007814857 6:44514488-44514510 CTGTGTCCTTACGTGGTGGAAGG - Intergenic
1007828114 6:44616975-44616997 CTGCATCCTCACATGGTGGAGGG - Intergenic
1007953030 6:45889253-45889275 TTGTATCCTCACATGGTGGAGGG + Intergenic
1008644814 6:53503211-53503233 CTGTGTTCTTACATGGTGGAAGG - Intronic
1008668232 6:53738752-53738774 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1008928109 6:56908828-56908850 CTGTAAACTGTCATGGCGGTGGG - Intronic
1008959477 6:57251569-57251591 CTATTAACTGACATGGGGGAAGG + Intergenic
1009216468 6:60926362-60926384 CTGTGTTCTTACATGGTGAAAGG - Intergenic
1009304803 6:62075282-62075304 CTGTGTCCTCACATGGTGGAGGG - Intronic
1009403370 6:63282495-63282517 GTGTATCCTTACATGGTGGAAGG + Intronic
1009547883 6:65045570-65045592 CTGTAACCTGACATGGCAGAAGG - Intronic
1009623144 6:66101337-66101359 CTGTACCCTCACATGGTGGCAGG + Intergenic
1009671252 6:66753861-66753883 CTGTGTCCTTACATGTTGGAAGG + Intergenic
1009759506 6:67985526-67985548 CTGTATCCTCACATGGTGGTAGG - Intergenic
1009763131 6:68034818-68034840 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1009947416 6:70355914-70355936 CTGTATCCTCACATGGTGGAAGG - Intergenic
1010367595 6:75069850-75069872 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1010649474 6:78434565-78434587 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1010731023 6:79391505-79391527 CTGTATTCTCACATGATGGAAGG + Intergenic
1010986967 6:82435703-82435725 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1011127355 6:84021438-84021460 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1011627996 6:89298903-89298925 CTGTAACCTCACATAGTGGGTGG - Intronic
1011859605 6:91738264-91738286 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1012448250 6:99328366-99328388 CTGTAACCTCATATGGTGGAAGG - Intronic
1012522075 6:100134104-100134126 CTGTAGACTTACTTGGTGCTTGG - Intergenic
1012768631 6:103400552-103400574 CTGTGATCTTATGTGGTGGAGGG + Intergenic
1012795986 6:103761958-103761980 CTGCATCCTTACATGGTGGAAGG + Intergenic
1012806617 6:103902901-103902923 CTGGTAACTAACTTGGTGGAGGG + Intergenic
1012849429 6:104429165-104429187 CTGTGTCCTTACATGGTAGAAGG - Intergenic
1012912497 6:105134463-105134485 CTGTAAACCTACATAGTGTTTGG - Intronic
1012926617 6:105274267-105274289 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1013478186 6:110529123-110529145 CTGTAACCTCACAAGGCGGAAGG - Intergenic
1013665366 6:112342271-112342293 CTGATAACTTACATGGAGGAAGG + Intergenic
1013754339 6:113443368-113443390 CTGTAATCTCACATGGTGGGAGG - Intergenic
1013823719 6:114185591-114185613 CAGTAAACTTGCTTGATGGAGGG - Intronic
1013957861 6:115861395-115861417 CTGTGGACTCATATGGTGGAAGG + Intergenic
1014008135 6:116444714-116444736 CTGTAGCCTCACATGTTGGAAGG - Intergenic
1014127097 6:117789318-117789340 CTGTGATCTCACATGGTGGAAGG + Intergenic
1014181957 6:118394511-118394533 CTGTGTTCTTACATGGTGAAGGG + Intergenic
1014503618 6:122225793-122225815 CTGCATCCTCACATGGTGGAAGG + Intergenic
1014642160 6:123926010-123926032 CTGTGTCCTCACATGGTGGAAGG + Intronic
1015256814 6:131186705-131186727 CTGTATCCTCACATGGTGGAGGG + Intronic
1015369792 6:132437749-132437771 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1015684675 6:135846678-135846700 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1016241714 6:141939124-141939146 CTGTAATTTTACATAGTTGATGG - Intergenic
1016353177 6:143189992-143190014 CTGTGTCCTCACATGGTGGAAGG + Intronic
1016540382 6:145157872-145157894 CTGTATCCTCACAAGGTGGAAGG - Intergenic
1016571242 6:145515545-145515567 CTCTAACCTCACATGGTAGAAGG + Intronic
1016732408 6:147440746-147440768 CTCTAATCTCACATAGTGGAAGG + Intergenic
1016935969 6:149449818-149449840 CTGGAAACTGCCATGATGGATGG + Intronic
1017048330 6:150367799-150367821 CTGTAACCTCACACAGTGGATGG - Intergenic
1017155375 6:151318160-151318182 CTGTAACCTCACATGGTGAAAGG - Intronic
1017187486 6:151616803-151616825 CTGTGTCCTCACATGGTGGAAGG + Intronic
1017338220 6:153287139-153287161 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1017363248 6:153602147-153602169 TTGTGTTCTTACATGGTGGAAGG + Intergenic
1017555697 6:155564332-155564354 CTGTGTCATTACATGGTGGAGGG - Intergenic
1017595650 6:156025907-156025929 CTGTGTCCTCACATGGTGGAGGG - Intergenic
1017607680 6:156150875-156150897 CTGTATTCTCACATGGTGGAAGG + Intergenic
1017852345 6:158315790-158315812 CTGTGTCCTCACATGGTGGAAGG + Intronic
1018520576 6:164645662-164645684 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1018667191 6:166149450-166149472 CTGAAAAGTTACATGGTGAAGGG + Intergenic
1019068741 6:169324488-169324510 CTGTGTTCTTACATGGTGGAAGG + Intergenic
1020916570 7:14201176-14201198 CTGTAACCTTACAGGATGGAAGG + Intronic
1021022275 7:15616954-15616976 GTGTGAACTTACATGGTAAAGGG - Intronic
1021487970 7:21187714-21187736 CTGTAGCCCTACATGGTAGAAGG - Intergenic
1021608357 7:22432127-22432149 CTCTAACCTTACATGGCAGAAGG - Intronic
1022647614 7:32245794-32245816 CTGTGTCCTCACATGGTGGAAGG + Intronic
1023385001 7:39647735-39647757 CTGTAACCTCACATGGTGGAAGG - Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1023961391 7:44929592-44929614 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1025240122 7:57264779-57264801 CTGTAAACATACATTCAGGATGG - Intergenic
1026491369 7:70866686-70866708 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1027367010 7:77468964-77468986 CTGTAACCTCACATCATGGAAGG - Intergenic
1027617649 7:80443650-80443672 CTGTGTCCTCACATGGTGGAAGG + Intronic
1027724678 7:81789104-81789126 CTGTGTGCTGACATGGTGGATGG - Intergenic
1028414529 7:90566027-90566049 CTGTGACCTCATATGGTGGAAGG - Intronic
1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG + Intronic
1028799572 7:94947593-94947615 CTGTAAAGTGACATGCTAGAAGG + Intronic
1029178630 7:98683470-98683492 CTGTGTCCTTACATGGAGGAGGG - Intergenic
1029847103 7:103423622-103423644 CTGTATCCTCACATGGCGGAAGG - Intronic
1029877450 7:103769348-103769370 CTGTATCCTCACGTGGTGGAAGG - Intronic
1029961950 7:104697035-104697057 TTGTGTCCTTACATGGTGGAAGG + Intronic
1030254510 7:107493172-107493194 CTGCATCCTTACGTGGTGGAAGG - Intronic
1030421051 7:109306707-109306729 TTGTCACTTTACATGGTGGAAGG + Intergenic
1030906237 7:115186894-115186916 CTGCATAATTACATCGTGGAAGG + Intergenic
1030992714 7:116319625-116319647 CTGTGTCCTTATATGGTGGAAGG - Intronic
1031058865 7:117026684-117026706 CTGTAAGCTTAGATGGTAGATGG - Intronic
1031213514 7:118860749-118860771 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1031285650 7:119863894-119863916 CTGTAACCTCACATGGCAGAAGG - Intergenic
1031570613 7:123354849-123354871 CTGTAACCTCACATGGTAGAAGG + Intergenic
1031609536 7:123808838-123808860 CTGTTTCCTCACATGGTGGAAGG + Intergenic
1032381617 7:131489680-131489702 CTGTAAAAATAAATGGTGGAGGG - Exonic
1032761887 7:134951063-134951085 CTGTGTCCTTACATGGTGGAAGG + Intronic
1033079865 7:138285251-138285273 CTGTGCCCTTACAGGGTGGAAGG - Intergenic
1033092783 7:138402504-138402526 CTGCATCCTTACATGGTAGAAGG - Intergenic
1033283743 7:140023510-140023532 CTGTAACCCTACGCGGTGGAAGG - Intergenic
1033668811 7:143469789-143469811 CTGCAGACTTACATTGTAGAAGG - Intergenic
1034363672 7:150525271-150525293 CTATAACCTCACATGGTGAAAGG + Intergenic
1034642773 7:152617950-152617972 TTGTAACCTCACATGGTGGAAGG - Intergenic
1034688475 7:152994950-152994972 TTGTAACCTCACATGATGGAAGG - Intergenic
1034724633 7:153324176-153324198 CCGTAAAAATATATGGTGGATGG - Intergenic
1034826370 7:154268423-154268445 CTGTATTCTCATATGGTGGATGG + Intronic
1035635003 8:1137991-1138013 CTGTAATCCTACATGATGGGAGG - Intergenic
1035819988 8:2580585-2580607 CTGTAAACCCACATAGGGGAAGG - Intergenic
1037642423 8:20758753-20758775 CTGTATGCTTACATGGTGGAAGG + Intergenic
1038381268 8:27096598-27096620 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1038680434 8:29662502-29662524 CTGTGACCTCACATGGTAGAAGG + Intergenic
1039099742 8:33928481-33928503 CTGCATTCTCACATGGTGGAAGG + Intergenic
1039214808 8:35258175-35258197 CAGTGTTCTTACATGGTGGAAGG + Intronic
1039237491 8:35517890-35517912 CTGTAACATCACATAGTGGAAGG + Intronic
1039274051 8:35915420-35915442 CTGTATCCTTACATGGTAGAAGG + Intergenic
1039647615 8:39304779-39304801 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1039660527 8:39457693-39457715 TTCTAATCTTACATAGTGGAAGG + Intergenic
1039806758 8:41006522-41006544 CTGTAATCTCACGTGGTAGAAGG - Intergenic
1040433641 8:47368108-47368130 GTGTAACCTCACATGGTGGAAGG + Intronic
1041036793 8:53799807-53799829 CTGTAAACTCAGATGGCAGAGGG - Intronic
1041517277 8:58714353-58714375 CTGTATCTTTACATGGTAGAAGG - Intergenic
1041573019 8:59359049-59359071 CTCTTAACTTAGATGGTGGAAGG + Intergenic
1041658195 8:60375170-60375192 CTGTGTCCTTATATGGTGGAAGG - Intergenic
1041737731 8:61129656-61129678 CTGTGTCCTTGCATGGTGGAAGG + Intronic
1041809661 8:61894094-61894116 CTGCAACATTCCATGGTGGAAGG - Intergenic
1041862407 8:62529557-62529579 CTGTAAGCTCATATGGTGGAAGG - Intronic
1042114305 8:65414518-65414540 CTGCATTCTTGCATGGTGGAAGG + Intergenic
1042411409 8:68470739-68470761 CTGTGTCCTCACATGGTGGAAGG + Intronic
1042520499 8:69706578-69706600 ATGTGAAGTTACATGGTGGGAGG + Intronic
1042628635 8:70790916-70790938 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1042652881 8:71062390-71062412 TTGTAACCTCACATGATGGAAGG + Intergenic
1042659669 8:71140843-71140865 CTGTAACCTCACATGATGAAAGG + Intergenic
1042686448 8:71446405-71446427 CAGGAAACTTACATGGCAGAAGG - Intronic
1042736744 8:71998176-71998198 CTGTGTTCTCACATGGTGGAAGG + Intronic
1042775884 8:72430808-72430830 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1043011645 8:74888499-74888521 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1043022429 8:75020500-75020522 CTGTGTCCTCACATGGTGGAGGG + Intronic
1043068875 8:75612939-75612961 CAGGAAACTGGCATGGTGGAAGG + Intergenic
1043158381 8:76815446-76815468 CAGTATCCTCACATGGTGGAAGG + Intronic
1043798441 8:84576938-84576960 CTGTAAACTAACATGAAGGTTGG - Intronic
1044385822 8:91587277-91587299 CTGTGACTTCACATGGTGGAAGG - Intergenic
1044435072 8:92151983-92152005 CTATAAACTTACATGCTTTAAGG - Intergenic
1044548145 8:93482337-93482359 CTGTATCCTCACATGGTGGAAGG - Intergenic
1044639608 8:94364988-94365010 CTGTTACCTCACATGGTGGAAGG - Intergenic
1045186569 8:99844321-99844343 CTGTAACCTCACATGATGGAAGG + Intronic
1045404475 8:101852008-101852030 CTGCATCCTCACATGGTGGAAGG - Intronic
1045998774 8:108395211-108395233 CAGGAAACTTACATGGCAGAAGG + Intronic
1046079430 8:109353341-109353363 CTGCATCCTCACATGGTGGAAGG + Intergenic
1046308617 8:112403589-112403611 CTGTGTCCTCACATGGTGGAAGG + Intronic
1046616294 8:116481180-116481202 CTGTATCCTCACATGGTAGAAGG + Intergenic
1046892511 8:119438386-119438408 TTGTAATCTTACATGGTAGAAGG - Intergenic
1046913258 8:119652175-119652197 CTGTAACCTCACATTATGGAAGG + Intronic
1046970648 8:120219522-120219544 CTGTGCCCTTACCTGGTGGAAGG + Intronic
1047028562 8:120851215-120851237 CTGTATCCTCACATGGTAGAAGG - Intergenic
1047432862 8:124807665-124807687 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1047846201 8:128808073-128808095 CTGTTACCTCATATGGTGGAAGG - Intergenic
1048465552 8:134662147-134662169 CTGTGTCCTCACATGGTGGAAGG + Intronic
1048841687 8:138572348-138572370 CTGTAACCTCATATGGAGGAGGG + Intergenic
1048874634 8:138827382-138827404 CTGTACTCTCACATGGTGGGAGG - Intronic
1049254822 8:141608158-141608180 CTGTGGCCTCACATGGTGGATGG - Intergenic
1049323376 8:142009282-142009304 CTGTGCCCTCACATGGTGGATGG - Intergenic
1049459341 8:142716488-142716510 CTGCAAAGTTACATGGCAGAGGG - Intergenic
1050487394 9:6148585-6148607 CTGTATCATAACATGGTGGAGGG - Intergenic
1050529530 9:6576306-6576328 CTGTGTCCTCACATGGTGGAAGG + Intronic
1050605400 9:7295967-7295989 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1050613090 9:7373359-7373381 CTGTAACCTCACATGTAGGAAGG - Intergenic
1051021685 9:12552581-12552603 CTGTAACCTTAAATGGAAGAAGG + Intergenic
1051297517 9:15612009-15612031 CTGTGTCCTAACATGGTGGAAGG - Intronic
1051722577 9:20053675-20053697 CTGTAAACCTCCATAATGGAAGG - Intergenic
1051737377 9:20215162-20215184 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1051861212 9:21627236-21627258 TTGTATCCTCACATGGTGGAAGG - Intergenic
1051882977 9:21859026-21859048 CTGGAACCTCACACGGTGGAAGG + Intronic
1052083411 9:24234771-24234793 CTGTATTCTCACATGGTGAAAGG + Intergenic
1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG + Intergenic
1052371843 9:27674379-27674401 CTGCAAACTTACCTGGAAGAAGG - Intergenic
1052378735 9:27746145-27746167 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1053272267 9:36758573-36758595 CTGTCTCCCTACATGGTGGAAGG - Intergenic
1053446260 9:38155460-38155482 CTGTGTCCTTGCATGGTGGAAGG + Intergenic
1053723363 9:40971979-40972001 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1054702233 9:68424399-68424421 CTGTGTCCTCACATGGTGGAAGG + Intronic
1054717829 9:68574737-68574759 CTATAAAATAACATGGTTGAAGG + Intergenic
1055252378 9:74323291-74323313 CTGTATTCTTACAGGGGGGAAGG + Intergenic
1055277784 9:74639368-74639390 CTGCAAACTGACATGGGGAAGGG + Intronic
1055336036 9:75234548-75234570 CTGCATTCTGACATGGTGGAAGG - Intergenic
1055390359 9:75815271-75815293 CTGTAGCCTTACATAGTGGAAGG + Intergenic
1055618210 9:78095112-78095134 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1055681475 9:78720264-78720286 TTGTAACCTCACGTGGTGGAAGG + Intergenic
1055768611 9:79692076-79692098 CTCAAAACTAACATGGGGGAGGG - Intronic
1056222955 9:84468041-84468063 CTGTAACCTCACTTGGTGGAAGG - Intergenic
1057043219 9:91862707-91862729 CTGTGTCCTCACATGGTGGAGGG - Intronic
1057056284 9:91963700-91963722 CTGTATCCTCACATGGTGGAGGG - Intergenic
1057137785 9:92706043-92706065 CTGTAACTTCAGATGGTGGAAGG + Intergenic
1057468754 9:95339084-95339106 CTCTAACCTCACATGGTGGAAGG + Intergenic
1057673306 9:97114895-97114917 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1057930921 9:99192135-99192157 CTGTACCTTTACATGATGGAAGG - Intergenic
1057974391 9:99588881-99588903 CTGCATCCTCACATGGTGGAAGG - Intergenic
1058351023 9:104024157-104024179 CTGTAAATTTGAATTGTGGAAGG - Intergenic
1058438621 9:104987407-104987429 CTGTATCCTAACAAGGTGGAAGG + Intergenic
1058561657 9:106235457-106235479 CTGTAATTTAACATGGTGGAAGG - Intergenic
1058823926 9:108758233-108758255 TTGTATCCTTACATGGTGGAGGG - Intergenic
1058827601 9:108788742-108788764 CTGTGTTCTTACATGGTAGAAGG + Intergenic
1058890737 9:109358517-109358539 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1058983179 9:110188864-110188886 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1059465147 9:114464452-114464474 CTGTGTCCTCACATGGTGGAAGG + Intronic
1059577973 9:115512240-115512262 CTGTGTCTTTACATGGTGGAAGG + Intergenic
1059613384 9:115923194-115923216 CTGTATCCTCACATGGTGGAAGG + Intergenic
1059726285 9:117011391-117011413 CTGTGTTCTCACATGGTGGAAGG - Intronic
1059758372 9:117315413-117315435 CTTTAAACTCACATGGTTGGCGG - Intronic
1060066575 9:120507098-120507120 TTGTAATCTTTCTTGGTGGAAGG - Intronic
1060070850 9:120546106-120546128 TTGTAAATTTGCTTGGTGGAGGG - Intronic
1060500375 9:124149260-124149282 CTGTTTCCTCACATGGTGGAAGG + Intergenic
1060607767 9:124932828-124932850 CTGTGCCCTCACATGGTGGAAGG + Intronic
1061266678 9:129509829-129509851 CTGTATCCTCACATGGTGGAAGG + Intergenic
1203367178 Un_KI270442v1:269211-269233 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1185641253 X:1589682-1589704 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1185676275 X:1851795-1851817 CTGTAAAGTGACATGGTGGAGGG + Intergenic
1185808302 X:3080661-3080683 CTGTGTCCTCACATGGTGGAAGG + Intronic
1185839076 X:3371815-3371837 CTGTGTCCTTACATGGTGGAAGG - Intergenic
1185842601 X:3406530-3406552 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1185869679 X:3653257-3653279 CTGTGTCCTCACATGGTGGAAGG - Intronic
1185872258 X:3673897-3673919 CTGTGTCCTCACATGGTGGAAGG - Intronic
1185876760 X:3708188-3708210 CTGTGTCCTCACATGGTGGAAGG - Intronic
1185997867 X:4973117-4973139 CTGTATCCTCACACGGTGGAAGG - Intergenic
1186027017 X:5324277-5324299 CTGTGTTCTCACATGGTGGAAGG - Intergenic
1186029146 X:5347778-5347800 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186054869 X:5639407-5639429 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186066796 X:5775268-5775290 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1186170547 X:6872009-6872031 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1186174509 X:6910901-6910923 GTGTATCCTCACATGGTGGAAGG + Intergenic
1186178797 X:6952750-6952772 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186228984 X:7432099-7432121 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186281575 X:7998803-7998825 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186364411 X:8876014-8876036 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186408755 X:9327143-9327165 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1186442746 X:9600301-9600323 CTGTGTTCTCACATGGTGGAAGG + Intronic
1186472376 X:9831788-9831810 CTGTATCCATGCATGGTGGAAGG + Intronic
1186695212 X:12023142-12023164 CTGTAACCTCATATGGTAGAAGG - Intergenic
1186963463 X:14762130-14762152 CTGCATCCTCACATGGTGGAAGG + Intergenic
1187762070 X:22598321-22598343 CTGTACCTTCACATGGTGGAAGG - Intergenic
1187948364 X:24448225-24448247 CTGAATCCTCACATGGTGGAAGG + Intergenic
1188425567 X:30043278-30043300 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1188431950 X:30113575-30113597 CTGTGACATCACATGGTGGAAGG + Intergenic
1188472423 X:30555361-30555383 CTGTTAACTTACATGGCAAAAGG + Intergenic
1188675008 X:32928763-32928785 CTGTTAACTTACATGGGGTTGGG + Intronic
1188983825 X:36751960-36751982 CTATAACCTCACATGGTGCAAGG - Intergenic
1189107294 X:38250118-38250140 CTCTATACTTCCCTGGTGGATGG + Intronic
1189554201 X:42125509-42125531 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1189633775 X:42983056-42983078 CTGCATACTCACATGGTGGAAGG + Intergenic
1189740147 X:44109446-44109468 CTGCATCCTCACATGGTGGAAGG + Intergenic
1189774484 X:44458151-44458173 CTGTATACTTACATGGCAGAAGG + Intergenic
1190163960 X:48056164-48056186 ATGTATCCTCACATGGTGGAAGG + Intronic
1190224075 X:48532370-48532392 CTGTACCCTTATATGGTGGGAGG + Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1190370326 X:49734129-49734151 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1190466857 X:50733508-50733530 CTGTATCATTCCATGGTGGAAGG - Intronic
1192275268 X:69623366-69623388 CTGTATCCTCACGTGGTGGAAGG + Intronic
1192305138 X:69951236-69951258 CTGTGTACTCACATGATGGAAGG - Intronic
1192374174 X:70542251-70542273 CTGTAAGCTCACATGGCAGAAGG - Intronic
1192607564 X:72534965-72534987 CTGTAAATTTCCATGGTTGTTGG + Intronic
1193136951 X:77983008-77983030 CTGTGTCCTCACATGGTGGAAGG + Intronic
1194173813 X:90622481-90622503 CTGTGTCCTTACATGGTGAAAGG - Intergenic
1194547647 X:95257552-95257574 CTGCACCATTACATGGTGGAGGG + Intergenic
1194699092 X:97091874-97091896 CCCAAAACTTGCATGGTGGAGGG + Intronic
1194736713 X:97521127-97521149 CTGTGCCCTCACATGGTGGAAGG - Intronic
1195163963 X:102198912-102198934 CTCTAACCTCACATGGAGGAAGG - Intergenic
1195194898 X:102488183-102488205 CTCTAACCTCACATGGAGGAAGG + Intergenic
1195265918 X:103179636-103179658 CTGTATGCTTACATGGCAGAAGG + Intergenic
1195309771 X:103620791-103620813 CTGTGTACTCACATGGTAGAAGG + Intronic
1195407730 X:104535157-104535179 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1195779816 X:108449722-108449744 CTGTGACCTCACATGGTGAAAGG + Intronic
1196076740 X:111586080-111586102 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1196323218 X:114368813-114368835 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1196567229 X:117222411-117222433 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1196567653 X:117227838-117227860 CTGCAATCTTACATAATGGAAGG - Intergenic
1196937710 X:120745973-120745995 CTGTGCCCTCACATGGTGGAGGG - Intergenic
1197037711 X:121897028-121897050 CTGTGTCTTTACATGGTGGAAGG - Intergenic
1197063796 X:122214848-122214870 CTGTGTTCTCACATGGTGGAAGG + Intergenic
1197712639 X:129682824-129682846 CTGTATCCTCACAAGGTGGAAGG + Intergenic
1198009738 X:132539403-132539425 CTGTGTCCTAACATGGTGGAAGG + Intergenic
1198063408 X:133070918-133070940 CTATAAAATTAAATGGTGGCCGG + Intronic
1198410927 X:136367019-136367041 CTATAACCTCACATGGTGAAAGG - Intronic
1198449382 X:136751676-136751698 CTATGTCCTTACATGGTGGAAGG - Intronic
1198671778 X:139088914-139088936 CTGTGTCCTCACATGGTGGAAGG - Intronic
1198891844 X:141404996-141405018 CTGTGTCCTCACATGGTGGATGG - Intergenic
1199585255 X:149408248-149408270 CTGTATCCTCACATAGTGGAAGG - Intergenic
1199589371 X:149452115-149452137 CTGTGTACTCACGTGGTGGAAGG - Intergenic
1199731167 X:150633612-150633634 CTGTACCCTTAAATGGTAGATGG + Intronic
1199747810 X:150785034-150785056 CTGGGAATTTACATGGTGGAAGG + Intronic
1199884099 X:152001923-152001945 CTGCATCCTTACATGGTAGAAGG - Intergenic
1200284826 X:154810615-154810637 CTGAATTCTCACATGGTGGAAGG + Intronic
1200520033 Y:4200171-4200193 CTGTGTCCTTACATGGTGAAAGG - Intergenic
1200788603 Y:7280222-7280244 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1200791646 Y:7304784-7304806 CTGTGTCCTCACATGGTGGAAGG + Intergenic
1200808265 Y:7454955-7454977 CTGTGTTCTTACATGGTGGAAGG - Intergenic
1200842324 Y:7795392-7795414 CTGTGTCCTCACATGGTGGAAGG - Intergenic
1201232841 Y:11881682-11881704 CTGTGTTCTTACATGGTGGAAGG + Intergenic
1201236717 Y:11919030-11919052 CTGTGTCCTTATATGGTGGAAGG + Intergenic
1201251519 Y:12063224-12063246 CTGTGTCCTTACATGGTGGAAGG + Intergenic
1201254707 Y:12095894-12095916 CTGTGACGTCACATGGTGGAAGG + Intergenic
1201547352 Y:15180291-15180313 CTTTAAACTTGCATGAAGGAAGG - Intergenic
1201597146 Y:15682957-15682979 CTGCATCCTCACATGGTGGAAGG - Intergenic
1201621550 Y:15964602-15964624 CAGGAAACTTACATTGTGGAAGG - Intergenic
1201906414 Y:19090263-19090285 TTGTATCCTCACATGGTGGAAGG - Intergenic
1202282530 Y:23204910-23204932 CTGTATTCTTACATGGTAGAAGG - Intergenic
1202283360 Y:23213609-23213631 CTGTATTCTTACATGGTAGAAGG + Intergenic
1202434202 Y:24819295-24819317 CTGTATTCTTACATGGTAGGAGG - Intergenic
1202435037 Y:24827995-24828017 CTGTATTCTTACATGGTAGGAGG + Intergenic