ID: 1172169210

View in Genome Browser
Species Human (GRCh38)
Location 20:32918710-32918732
Sequence GAGCATTGTGGGCCTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 452}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172169204_1172169210 -5 Left 1172169204 20:32918692-32918714 CCTCAACTCACTTGTTTTGAGCA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1172169210 20:32918710-32918732 GAGCATTGTGGGCCTGGGCAGGG 0: 1
1: 0
2: 1
3: 45
4: 452
1172169202_1172169210 5 Left 1172169202 20:32918682-32918704 CCTTTAGGTCCCTCAACTCACTT 0: 1
1: 0
2: 0
3: 11
4: 132
Right 1172169210 20:32918710-32918732 GAGCATTGTGGGCCTGGGCAGGG 0: 1
1: 0
2: 1
3: 45
4: 452
1172169201_1172169210 13 Left 1172169201 20:32918674-32918696 CCAAAGTGCCTTTAGGTCCCTCA 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1172169210 20:32918710-32918732 GAGCATTGTGGGCCTGGGCAGGG 0: 1
1: 0
2: 1
3: 45
4: 452
1172169203_1172169210 -4 Left 1172169203 20:32918691-32918713 CCCTCAACTCACTTGTTTTGAGC 0: 1
1: 0
2: 1
3: 9
4: 148
Right 1172169210 20:32918710-32918732 GAGCATTGTGGGCCTGGGCAGGG 0: 1
1: 0
2: 1
3: 45
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172169210 Original CRISPR GAGCATTGTGGGCCTGGGCA GGG Intronic
900223112 1:1519971-1519993 CAGCAGTGTGGGCCTGTCCATGG + Intronic
900369120 1:2323684-2323706 GGGCTTGGTGGGCCTGGGCTGGG - Intronic
900580598 1:3406795-3406817 GGGCCTTGTGGGCCAGTGCAGGG + Intronic
900922931 1:5685135-5685157 GAACCTTGTGGGGCTGGGTAGGG + Intergenic
901311235 1:8270986-8271008 GAGCAATGTGGGCATGAGAAGGG - Intergenic
901630269 1:10644628-10644650 GAGCATCCAGGGCCTGGGCGTGG - Intronic
902814406 1:18908005-18908027 GAGCTTTCTAGGCCTGGGTAGGG - Exonic
903150614 1:21405396-21405418 TAGCATTCTGGGCCTGTGCTGGG + Intergenic
903153581 1:21429682-21429704 GGACATAGTGGGGCTGGGCAGGG + Intergenic
903591277 1:24457689-24457711 GAGCAGTGAGGGCATGGGCTGGG - Intronic
903672665 1:25045870-25045892 CAGCCTTGTGGTCGTGGGCAGGG - Intergenic
904568863 1:31445549-31445571 TTGCAGTGTGGCCCTGGGCAAGG + Intergenic
905170916 1:36109069-36109091 GAGCAGTAGGGGCCTGCGCAGGG - Intronic
905174827 1:36128613-36128635 GACCGTTCTAGGCCTGGGCAGGG + Intergenic
906710986 1:47929916-47929938 GGGCATTGGGGGGCTGGGCAAGG - Intronic
906773147 1:48503263-48503285 AAGCTTTGTGGGCATGGGTAAGG - Intergenic
907285588 1:53377488-53377510 CAGCACTGTGGTACTGGGCAGGG - Intergenic
907469598 1:54664616-54664638 GGGCATTGAGGGTCTTGGCAAGG + Intronic
909556068 1:76955834-76955856 CAGCATTGGCTGCCTGGGCAGGG + Intronic
910452399 1:87360439-87360461 GAGGAGTGTGGGCCTGGACGAGG + Intergenic
910565058 1:88634419-88634441 GAGTATTCTGTGCCTTGGCAAGG + Intergenic
911163944 1:94708844-94708866 GACCAATGTGGGCCTGGGATGGG + Intergenic
911812080 1:102295813-102295835 GAGCAGTGGGGACCTGGGCCTGG - Intergenic
913400716 1:118429742-118429764 GAGTATTTTTGGGCTGGGCATGG + Intergenic
913591909 1:120337461-120337483 GAGCCCAGTGGGCCTGGCCATGG - Intergenic
913651447 1:120917685-120917707 GAGCCCAGTGGGCCTGGCCATGG + Intergenic
913959997 1:143332082-143332104 GTGCATTTTGGGGCCGGGCATGG - Intergenic
914054354 1:144157655-144157677 GTGCATTTTGGGGCCGGGCATGG - Intergenic
914124792 1:144808706-144808728 GTGCATTTTGGGGCCGGGCATGG + Intergenic
914169662 1:145211386-145211408 GAGCCCAGTGGGCCTGGCCATGG - Intergenic
914524776 1:148455348-148455370 GAGCCCAGTGGGCCTGGCCATGG - Intergenic
914598899 1:149180485-149180507 GAGCCCAGTGGGCCTGGCCATGG + Intergenic
914641625 1:149611786-149611808 GAGCCCAGTGGGCCTGGCCATGG + Intergenic
915058471 1:153158972-153158994 GAGCAGTGGGGCCCTGGGCCTGG + Intergenic
916858297 1:168774757-168774779 GAAAAGTGTGGGCCAGGGCAGGG - Intergenic
918956758 1:191217825-191217847 GAGCAGTGGGGACCTGGGCTTGG + Intergenic
919847976 1:201653610-201653632 GTGCATTGTGGGGCTGGGGTGGG + Intronic
920404151 1:205696631-205696653 GTACATTATGGGGCTGGGCATGG - Intergenic
920647549 1:207814535-207814557 GTGCAGTGTGTCCCTGGGCATGG - Intergenic
921059469 1:211570908-211570930 AAGAATTGGGGGTCTGGGCAGGG - Intergenic
921179931 1:212624369-212624391 GGGCATTGTGGCCCTGGCCTGGG + Intergenic
921259109 1:213369845-213369867 GAGAATTGAGGGCCTGGGTTCGG + Intergenic
924334552 1:242974192-242974214 TAGCTATGTGGTCCTGGGCAAGG - Intergenic
924756002 1:246941615-246941637 GAGAATTCAGGGGCTGGGCATGG - Intergenic
1064027420 10:11859968-11859990 GAGGCTTGTGGCCCTCGGCAGGG - Intronic
1066214974 10:33277435-33277457 CAGCACTGTGGGCCTGATCACGG + Intronic
1066352594 10:34650497-34650519 GAGACCTGTGTGCCTGGGCAGGG + Intronic
1066421577 10:35268921-35268943 TAGCACTGTGGGCCTGTGAAGGG + Intronic
1067048201 10:42997684-42997706 GAGGATGCTGGGACTGGGCAGGG - Intergenic
1067199553 10:44155577-44155599 GAGCTGTGTGGGCCTAGGCCTGG + Intergenic
1068292778 10:55026590-55026612 GAGCAATATGGACCTGGGCCAGG + Intronic
1069439154 10:68412198-68412220 AAACATTTTTGGCCTGGGCACGG - Intergenic
1069657824 10:70103157-70103179 GGGCAATGTGGCCCTGGGCTTGG - Intronic
1069746756 10:70720003-70720025 GAGCATTGTGGGCTTGTGAGAGG + Intronic
1070130976 10:73655351-73655373 GAGCACTGAAGGCATGGGCAGGG + Intronic
1070151909 10:73810798-73810820 GAGCTGTGTGATCCTGGGCAAGG - Exonic
1070257318 10:74824413-74824435 GGCCATCTTGGGCCTGGGCATGG - Intergenic
1070439523 10:76429765-76429787 CAGCCATGGGGGCCTGGGCAGGG + Intronic
1072231728 10:93419451-93419473 GGGCATTTTGGGGCCGGGCACGG - Intronic
1072895739 10:99365077-99365099 GAGCACTTTGAGCCTGGGCTGGG + Intronic
1073064742 10:100751324-100751346 GAGCTTTGTGGGAGTTGGCAGGG - Intronic
1073306376 10:102505904-102505926 GAGAAAAGTGGGCCTGGGCTGGG + Intronic
1074421203 10:113310052-113310074 GAGCGCTGTGGGCCTGGGTGGGG - Intergenic
1074530137 10:114291369-114291391 GAGAATAGTGGTCCTGGCCACGG - Exonic
1074742561 10:116499353-116499375 CAGCATTGTGGACATGGGCAAGG + Intergenic
1074887229 10:117703777-117703799 AAGCAGTGTGCACCTGGGCATGG + Intergenic
1075372604 10:121950516-121950538 GAGGTATGTGGGGCTGGGCACGG + Intergenic
1075811449 10:125227604-125227626 GACCTTTGTGGGCTTGGCCAAGG + Intergenic
1076155492 10:128202031-128202053 GAGCAGTGGGGTCCTGGGCCTGG - Intergenic
1076522719 10:131090972-131090994 CAGCACTGTGGGCAGGGGCAGGG + Intergenic
1076696416 10:132249455-132249477 GACACCTGTGGGCCTGGGCAGGG + Intronic
1076696918 10:132251485-132251507 GAGCCCTGTGGCCCTGGGAAGGG + Intronic
1076785114 10:132745759-132745781 GGGTATGGTGGGCCCGGGCATGG + Intronic
1076785136 10:132745820-132745842 GGGTATGGTGGGCCTGGGCATGG + Intronic
1076785141 10:132745835-132745857 GGGCATGGTGGGCCCGGCCATGG + Intronic
1076826449 10:132972009-132972031 GAGCACTGCGGGACCGGGCAGGG + Intergenic
1076856414 10:133117468-133117490 GTGCACTGTGGACGTGGGCAGGG + Intronic
1077218289 11:1404244-1404266 GAGGAGTGAGGCCCTGGGCAGGG - Intronic
1078827013 11:14939091-14939113 GAGCAGTGGGGCCCTGGGCCTGG + Intronic
1079204472 11:18402243-18402265 GACAATTATGGGCCCGGGCACGG - Intronic
1079284666 11:19117563-19117585 GACCTCTGTGGGCCTGGGGAGGG + Intronic
1080501677 11:32877411-32877433 GAGCATTGAGGATCTGGGCTTGG + Intergenic
1080601876 11:33828992-33829014 GAGAATTTTGGGCCCGGGCTTGG + Intergenic
1081857343 11:46312221-46312243 GAGCATTGTGTGCCTTGCCCAGG + Intronic
1081933839 11:46890882-46890904 AAGCATTCTGAGGCTGGGCATGG - Intronic
1083955787 11:65982180-65982202 GAGCCTGGAGGACCTGGGCAGGG - Intergenic
1084169944 11:67396253-67396275 GAAGATGGCGGGCCTGGGCAGGG - Exonic
1085329205 11:75633705-75633727 GAGCCTTGTGGGCTTCTGCAGGG + Intronic
1085899884 11:80686406-80686428 GAGCAGTGTGGGCTTAGGAAGGG - Intergenic
1087082537 11:94185829-94185851 GAGGATTGTTTGCCTGGGCTTGG + Intergenic
1087104396 11:94395720-94395742 GAGCATGGTGGCCCTGGGTCAGG - Intronic
1087474354 11:98618211-98618233 GAGCAGTGGGGCCCTGGGCCTGG + Intergenic
1089550497 11:119272408-119272430 GAGCAGAATGGGGCTGGGCATGG - Intronic
1089736543 11:120553683-120553705 GAGCCCTATGGGCCTGGGGAGGG + Intronic
1090395069 11:126413666-126413688 GAGCATGGTGGGCCAGGGCGTGG + Intronic
1091585625 12:1814714-1814736 GAGCAATGTTGGCTTGGCCAAGG - Intronic
1092289571 12:7151070-7151092 AAGCCTGGTGGGGCTGGGCAGGG + Intronic
1092944344 12:13439069-13439091 GAGCAGTGGGGCCCTGGGCCTGG + Intergenic
1093038128 12:14352225-14352247 GAGCAGTGTAGTCCTGGGCCTGG + Intergenic
1093170736 12:15857444-15857466 GTTCATTGTGGGGCCGGGCACGG - Intronic
1094798510 12:34002670-34002692 GAGCAGGGTGGCCCTGGGCCTGG + Intergenic
1095586331 12:43853792-43853814 GATCATAGTGGGCCAGGACAGGG + Intronic
1095731589 12:45511751-45511773 GAGCACTGTGGCCCTGGGCCTGG + Intergenic
1096573205 12:52536491-52536513 GAGTATTGTAGGGCTGGGCACGG + Intergenic
1096604248 12:52753603-52753625 GAGCCTTTGGGGCCTTGGCATGG - Intergenic
1096640740 12:52992382-52992404 GAACATTCTGAGGCTGGGCACGG + Intergenic
1096767088 12:53899979-53900001 GATCATTGGTTGCCTGGGCAGGG + Intergenic
1097436809 12:59560082-59560104 GAGCATTGCTGTCTTGGGCAAGG - Intergenic
1098848249 12:75564437-75564459 CAGCAGAGTGGGCCTGGGCACGG - Intergenic
1099346586 12:81508229-81508251 GAGCTTTGTGGGGCCGGGCACGG + Intronic
1099376355 12:81899512-81899534 TGGCATTGTGGACGTGGGCAAGG - Intergenic
1100542918 12:95574884-95574906 GAGCACTGTGTGCCATGGCATGG + Intergenic
1100636082 12:96435932-96435954 AATCACTGTGGGGCTGGGCATGG - Intergenic
1102639330 12:114352719-114352741 GTGCATTGTGTGCCTTGCCATGG + Intergenic
1104205461 12:126634458-126634480 GAGCCCAGTGGGTCTGGGCAGGG - Intergenic
1104994095 12:132643280-132643302 GCGCTTTGTGGGCCTGTGCGTGG + Exonic
1106614689 13:31315819-31315841 GAGCAGTGGGGCCCTGGGCCAGG - Intronic
1108109645 13:47055080-47055102 GAGCATTGGCAGCCTTGGCAGGG + Intergenic
1108383284 13:49874721-49874743 GAGCAATGTGTTCCTGGTCAGGG - Intergenic
1108612388 13:52096920-52096942 GAGCAGTGGGGCCCTGGGCTTGG - Intronic
1108688966 13:52845980-52846002 GAACATGTTGGGCCTGGGCCCGG + Exonic
1110461736 13:75752583-75752605 CAGCATTGTGGGGATGGGAAGGG - Intronic
1110549481 13:76796201-76796223 GCACATTGTAGGCCTGGGAATGG - Intergenic
1111437025 13:88224481-88224503 CAGAACTGTGGGCCTGGGCGCGG - Intergenic
1111455575 13:88479440-88479462 GAGCATTTTGGGTCCAGGCAAGG + Intergenic
1112497272 13:99915154-99915176 GAGCCCTGTGGGGCTGGGGAGGG - Intergenic
1112514032 13:100036601-100036623 AAGCTTTTTGGGGCTGGGCATGG + Intergenic
1114683683 14:24507748-24507770 GAGGAGGGTGGGCCAGGGCAAGG - Intronic
1115337395 14:32255339-32255361 GAGCAGCCTGGGCCTGAGCAGGG - Intergenic
1115852537 14:37599188-37599210 GAGAAGTATGGGCCTGGCCAGGG + Intronic
1117066786 14:52019232-52019254 AGGCATACTGGGCCTGGGCATGG + Exonic
1117949546 14:61068395-61068417 GAGCCTTGTAGGCCATGGCATGG - Intronic
1118350178 14:64968026-64968048 GGGCATTGAGAGCCTGGCCAAGG - Intronic
1119153282 14:72385638-72385660 CAGCCTTGTGTCCCTGGGCAGGG - Intronic
1119320634 14:73728194-73728216 GACCAACTTGGGCCTGGGCACGG - Intronic
1119435557 14:74595602-74595624 GACCATCCTGGGCCTGGGCGCGG - Intronic
1119845282 14:77824722-77824744 AGGCATTTTGGGGCTGGGCATGG - Intronic
1120894916 14:89521021-89521043 GAGAATGGTGAGGCTGGGCACGG + Intronic
1121914105 14:97820482-97820504 GAGCAGTGGGGCCCTGGGCCTGG - Intergenic
1122361584 14:101170261-101170283 GAGCTCTCTGGGACTGGGCACGG - Intergenic
1122691724 14:103534853-103534875 GAGCACTGAAGGGCTGGGCAGGG + Exonic
1122890001 14:104727811-104727833 GAGCCCTGTGGTCCTCGGCAGGG - Intronic
1202835582 14_GL000009v2_random:75601-75623 GATCAGTGTGGGCCTGCTCAGGG + Intergenic
1123481989 15:20640691-20640713 GAGCATTCTGAGTCAGGGCAAGG - Intergenic
1123636023 15:22359674-22359696 GAGCATTCTGAGTCAGGGCAAGG + Intergenic
1123827774 15:24101118-24101140 GACCATGGAGGGACTGGGCAGGG + Intergenic
1123842228 15:24260527-24260549 GACCATGGAGGGACTGGGCAGGG + Intergenic
1124371506 15:29107072-29107094 GAGCCATGTGGCCCTGGGCAAGG + Intronic
1128217665 15:65945460-65945482 GAGCAGTGAGGGCCTGAGGAGGG + Intronic
1129207914 15:74048199-74048221 GAGAATGGTGGACATGGGCAGGG - Intergenic
1129265447 15:74390913-74390935 GAGCATGGGGGCCCTGGCCATGG - Intergenic
1130223293 15:82039455-82039477 GAACATTGTGGGCAAGGTCAAGG - Intergenic
1131432088 15:92395177-92395199 GAGCTTCCTGGCCCTGGGCAAGG + Intronic
1131732193 15:95293995-95294017 AAGCAATGTGTGCCTGGGTAAGG - Intergenic
1132871564 16:2117803-2117825 CAGCATCGTGGCCCTGGGCGAGG - Exonic
1133504619 16:6399199-6399221 GAGCAGGGTGGCCCTGGGCCTGG + Intronic
1134130503 16:11646409-11646431 TAGCATTTTGAGGCTGGGCACGG + Intergenic
1134520965 16:14919092-14919114 CAGCATCGTGGCCCTGGGCGAGG + Intronic
1134550607 16:15136881-15136903 CAGCATCGTGGCCCTGGGCGAGG - Intronic
1134708641 16:16317743-16317765 CAGCATCGTGGCCCTGGGCGAGG + Intergenic
1134715854 16:16357776-16357798 CAGCATCGTGGCCCTGGGCGAGG + Intergenic
1134809627 16:17156488-17156510 GAGCAAAGTGGGGCTGGGCAAGG - Intronic
1134900765 16:17935810-17935832 GAGCTTTCTGGGGCTGGGCATGG - Intergenic
1134950963 16:18350902-18350924 CAGCATCGTGGCCCTGGGCGAGG - Intergenic
1134958902 16:18394383-18394405 CAGCATCGTGGCCCTGGGCGAGG - Intergenic
1135105222 16:19643653-19643675 GAACAAAGTGGGGCTGGGCATGG + Intronic
1135161097 16:20097110-20097132 AAGAAGTGTGGGGCTGGGCATGG - Intergenic
1135181939 16:20282522-20282544 GGGCCTTGTGTGCCTGGCCAAGG + Intergenic
1136270865 16:29147519-29147541 GTGGAAAGTGGGCCTGGGCAGGG - Intergenic
1136341060 16:29643728-29643750 GTTCATTTTGGGCCCGGGCACGG - Intergenic
1136536187 16:30901181-30901203 GATAAATGTGGGGCTGGGCACGG - Intronic
1137668009 16:50262915-50262937 GAGCACTGTGTGCCAGGGCTGGG + Intronic
1138132629 16:54494113-54494135 GAACATTCTGGGTCTGGGCGTGG + Intergenic
1138856634 16:60701488-60701510 GAGGATTGTGGTCCTGTGCCTGG + Intergenic
1139529328 16:67535257-67535279 GGGCAGTGAGGGCCTGGCCAAGG + Intronic
1139723556 16:68877177-68877199 GAAAAATGTGGGGCTGGGCACGG + Intronic
1140061987 16:71578768-71578790 GAATATTTTGGGGCTGGGCATGG + Intergenic
1140472754 16:75224432-75224454 GAGCATGGTGGGGCTGGCCAAGG - Intronic
1140738551 16:77921172-77921194 TAGCATCATGGGGCTGGGCAAGG + Intronic
1141150275 16:81559855-81559877 AGGCATTGTGGGGCTGGGCGTGG + Intronic
1141279081 16:82614275-82614297 GAGCTGTGTGAGCTTGGGCAAGG + Intergenic
1141887233 16:86900839-86900861 GAGAATTGTGGCCCTTGGAAGGG - Intergenic
1142054594 16:87985143-87985165 GTGCTTTGTGGGCCTCGCCAGGG + Intronic
1142213932 16:88821746-88821768 GAGCATAGAAAGCCTGGGCAGGG + Intronic
1142227868 16:88886204-88886226 GAGCAGAGGGGGCCTGGGCTGGG + Intronic
1142541058 17:659810-659832 GAGCAGTGAGGGCCTGAACAAGG - Intronic
1142938778 17:3363001-3363023 GAGCAGTGGGGGCCTGGACCTGG + Intergenic
1143038647 17:4016238-4016260 GAGCATGGAGGGGCTGAGCACGG + Intronic
1143256079 17:5559012-5559034 GAGCTTGGAGAGCCTGGGCAAGG + Exonic
1143893442 17:10119366-10119388 GAGCACTGAGGGCCTGGGCCAGG - Intronic
1144056998 17:11552092-11552114 GAGCATTGTGGCCCTGGAGGAGG - Intronic
1144404793 17:14941944-14941966 GAGGATTGTGAGCCCGGGAAGGG + Intergenic
1144630225 17:16867774-16867796 GAGCAATGTGGGGCAGGGCCAGG + Intergenic
1145939046 17:28732161-28732183 TTGCATTCTGGGGCTGGGCATGG + Intronic
1146261937 17:31427682-31427704 GAGGACTGTAGGCCTGAGCATGG + Intronic
1146278676 17:31531209-31531231 GAGCAGTGTGGGGCTGGGGGTGG + Intronic
1146369664 17:32257674-32257696 TAGCCTTGTGGCCCTGGGGAAGG - Intergenic
1146676066 17:34774676-34774698 GAGCTCTGTGGGCCTGGGCCGGG - Intergenic
1147122404 17:38343465-38343487 GAAAATTGGCGGCCTGGGCAAGG + Exonic
1147842472 17:43381735-43381757 AAGAATGGTGGGGCTGGGCAGGG - Intergenic
1148927603 17:51101055-51101077 GACCCTTATGGGGCTGGGCATGG + Intronic
1148937376 17:51174425-51174447 AAGCATAGTGGCCGTGGGCATGG - Intergenic
1149568010 17:57653088-57653110 GAGGAGGGTGGGGCTGGGCAGGG + Intronic
1150638648 17:66934251-66934273 GAGCTGTGTGACCCTGGGCAAGG - Intergenic
1151155424 17:72120876-72120898 GAGGATTGTGGCACTGGGCTGGG - Intergenic
1151534433 17:74730673-74730695 GAGCAGACTGGGCCTGGGCTGGG - Intronic
1151948219 17:77330901-77330923 AAGCTGTGTGGGGCTGGGCAGGG - Intronic
1152284473 17:79404232-79404254 GAGGACAGTGGGCGTGGGCAGGG + Intronic
1152408187 17:80109137-80109159 GGGCCCGGTGGGCCTGGGCATGG + Intergenic
1152643637 17:81459178-81459200 GGGCATGGTGGGGCAGGGCAGGG + Intronic
1152678490 17:81653628-81653650 GTGGATTGTGGGCCGGGGCGAGG - Intronic
1152821189 17:82438684-82438706 GAGCTTTGTGGGTGAGGGCACGG - Intronic
1154102093 18:11485426-11485448 GTGCATGGTGGGCCAGAGCAAGG + Intergenic
1154414735 18:14170872-14170894 GGGCAGTGTTGGGCTGGGCAGGG + Intergenic
1156904053 18:42333558-42333580 GGGCAGAGTGGGGCTGGGCATGG - Intergenic
1157040085 18:44028290-44028312 GAGCAGTGGGGTCCTGGGCCTGG + Intergenic
1157382124 18:47227932-47227954 GAGCACTGTGGACCTAGGCTAGG - Intronic
1157846007 18:51004682-51004704 TATCACTGTGGGGCTGGGCATGG + Intronic
1160790015 19:918896-918918 GCGCATGGTGGGGCGGGGCAGGG + Intronic
1161195158 19:2982604-2982626 GAGCCTTGTGGGCCGTGGGAAGG + Intronic
1161390238 19:4016876-4016898 GAGAATGGTGGGCCCGGGGAAGG + Intronic
1161420781 19:4174987-4175009 GTGCATGGTGGCCCTGGGCAGGG + Intronic
1161801844 19:6420645-6420667 GGGCATTGTGGGCCTTGGCCTGG + Intronic
1162102671 19:8349418-8349440 AAGCATTGCATGCCTGGGCATGG + Intronic
1162374155 19:10295266-10295288 GATCGTTGTGGGCCGGAGCAGGG + Intronic
1162573691 19:11486724-11486746 GGGCCTTGTGGGCCTGGCCCAGG + Intronic
1163695439 19:18761227-18761249 CAGCAACGTGGGCCAGGGCAGGG - Intronic
1163885556 19:19961858-19961880 GTGCATTGTGTCCCTGGGTACGG - Intergenic
1166196786 19:41211640-41211662 GAGGCATGTCGGCCTGGGCATGG + Intergenic
1166217334 19:41344273-41344295 GAGTATTCTGGGGCTGGGCATGG - Intronic
1166643077 19:44511306-44511328 GAGAGTTCTGGGCCAGGGCAAGG - Intronic
1166643425 19:44513277-44513299 GAGGACTGGGGACCTGGGCAAGG + Exonic
1166737863 19:45096898-45096920 GATGATCTTGGGCCTGGGCAGGG + Intronic
1167073728 19:47236183-47236205 GAACATTCCGGGGCTGGGCATGG - Intergenic
1167219045 19:48185423-48185445 GAGCATTAAGGGGCTGGGCACGG - Intronic
1167297235 19:48658480-48658502 GGGCTTTGTGGGGCAGGGCAGGG + Intergenic
1167300524 19:48674919-48674941 GGGCATTGTGTGGCTGGGTAGGG + Intergenic
1202693833 1_KI270712v1_random:110333-110355 GTGCATTTTGGGGCCGGGCATGG - Intergenic
925277352 2:2659673-2659695 GAGCAGTGGGGCCCTGGGCCCGG + Intergenic
925661629 2:6209222-6209244 GAGCAATGAGGCCCTGGGCCTGG - Intergenic
925915375 2:8600693-8600715 GAGAACCGTGGGCCTGGGCCCGG + Intergenic
926147610 2:10406230-10406252 GAACAGTGTGTGCCAGGGCATGG - Intronic
926297500 2:11579240-11579262 AGGCACTGGGGGCCTGGGCATGG - Intronic
926580272 2:14627032-14627054 GAGCACAGTGGGCGGGGGCACGG + Intergenic
926780269 2:16464476-16464498 CAGAATTGTGGGTGTGGGCAAGG + Intergenic
927712022 2:25332046-25332068 CAGCAATGTGGGCCTGGACAGGG - Intronic
928080683 2:28309808-28309830 GAGCTATGTTGGCCTGGGCCTGG - Intronic
928797492 2:35040163-35040185 GAGCAGTGGGGCCCTGGGCCTGG - Intergenic
929595202 2:43171177-43171199 GAGCTGTGTGGGGCTGGGAATGG + Intergenic
929934499 2:46284971-46284993 GAGCATTCCTGGCCTGGGAATGG - Intergenic
929963053 2:46510992-46511014 CACCACTGTGGGCCTGGGCCAGG + Intronic
930393034 2:50785536-50785558 CAGAAGTGTGGGGCTGGGCACGG - Intronic
932115333 2:69041734-69041756 GAAAATTGTGGGCAGGGGCAAGG + Intronic
932327543 2:70873059-70873081 GACCACTGTGGGCTTGGGGAGGG - Intergenic
932338116 2:70942639-70942661 GTGCTGTGTGGCCCTGGGCAAGG + Intronic
932715006 2:74094413-74094435 GAGCCTTGAGGGCCAGGGGAGGG + Intronic
933342243 2:81038324-81038346 CAGCATAGTGGACATGGGCAAGG - Intergenic
933952729 2:87344242-87344264 GTGCATTTTGGGGCCGGGCACGG + Intergenic
934236971 2:90240588-90240610 GTGCATTTTGGGGCCGGGCACGG + Intergenic
936600404 2:113889909-113889931 GAGCGCTGGGGGCCTGGGCCTGG + Intergenic
937267461 2:120625461-120625483 GAGCATTGAGGTCCAGGGGATGG - Intergenic
937889447 2:126926204-126926226 GAGCAGTGGGGCCCTGGGCCTGG - Intergenic
937984551 2:127632689-127632711 CAGCCTTGAGGGCCTGGGCTGGG - Intronic
938767603 2:134470759-134470781 GAGCCATCTGGGCCTGGGTAGGG - Intronic
940990630 2:160092651-160092673 CAGCGTTCTGGGCCTGGGCATGG - Intergenic
941250894 2:163160998-163161020 GATCATTGTGAGCCTGGGCTTGG - Intergenic
941594336 2:167456789-167456811 GAGGATGGTGGGCCTGGAGAGGG - Intergenic
941824707 2:169881467-169881489 TAGCTTTCTGGGGCTGGGCACGG - Intronic
942825460 2:180169807-180169829 GAGCAGTGGGGCCCTGGGCCTGG + Intergenic
942905434 2:181174574-181174596 GAGCAGTGTGAACCTGTGCATGG + Intergenic
944843285 2:203643932-203643954 GTGCAGTGTGGAGCTGGGCATGG - Intergenic
945076142 2:206041855-206041877 AAGTATTTTGGGGCTGGGCATGG + Intronic
946245568 2:218385269-218385291 GAGCTTGGGGGGCCTGGACAGGG + Intronic
948292446 2:236835779-236835801 GAGCAGTGGGGCCCTGGGCCTGG + Intergenic
948347757 2:237313331-237313353 GAGGACTGTAGCCCTGGGCAAGG - Intergenic
949027998 2:241775234-241775256 AAGAAGTGTGGGCCTGGGCAGGG - Intergenic
1169893111 20:10474631-10474653 GGGCCTTGGGGGCCTGGGCTGGG + Intronic
1170567578 20:17615693-17615715 GAGCCTTGAGGGCCTGGGGCTGG - Intronic
1170573503 20:17646143-17646165 GAGCTGGGTGGTCCTGGGCACGG + Intronic
1170748248 20:19120176-19120198 GAGCGTGCTCGGCCTGGGCATGG - Intergenic
1170759368 20:19236270-19236292 GAGCAGTGTGGGAGTGTGCAAGG + Intronic
1171483124 20:25468635-25468657 GAGAATTGGGGGACAGGGCAGGG - Intronic
1172101694 20:32487582-32487604 GAGCAATGTGGGCCAGGGGGAGG + Intronic
1172169210 20:32918710-32918732 GAGCATTGTGGGCCTGGGCAGGG + Intronic
1172174854 20:32966105-32966127 GTGAGTTGTGGGCCCGGGCAGGG + Intergenic
1172177355 20:32980436-32980458 GTGCATTGTGGACCTGGACTGGG + Intergenic
1172799437 20:37565680-37565702 GTGGAGAGTGGGCCTGGGCAGGG + Intergenic
1173358104 20:42314236-42314258 GACCACTTTGGGGCTGGGCACGG + Intronic
1173648972 20:44651268-44651290 GCGCTGTGTGGGCCTGGGCAGGG - Intronic
1173690761 20:44959559-44959581 AAGCATAGTGAGCCAGGGCAGGG - Intronic
1173895726 20:46549471-46549493 GAGCATAGTATGCCTGGGCCTGG + Intronic
1174118751 20:48246559-48246581 GAGCATAGTGACCCTGGGGAAGG - Intergenic
1175515091 20:59564375-59564397 CAGAGCTGTGGGCCTGGGCAGGG - Intergenic
1175776734 20:61658594-61658616 CACCAGTGTGGCCCTGGGCAGGG + Intronic
1175908177 20:62392021-62392043 GCGCTTTGTGGGCCAGGGGAAGG + Intronic
1175966780 20:62663944-62663966 TAGCATTGGAGGCCTGAGCAGGG - Intronic
1176858285 21:13987382-13987404 GGGCAGTGTTGGGCTGGGCAGGG - Intergenic
1177306085 21:19317538-19317560 GAGCAGTGGGGCCCTGGGCTTGG + Intergenic
1179230620 21:39500599-39500621 GAGCCTGGTGGGGCTGGGAATGG + Intronic
1179454772 21:41491502-41491524 GAACATCGTGTGCCTGGGCATGG - Intronic
1181421109 22:22799691-22799713 GAGGAATGCGGCCCTGGGCAGGG - Intronic
1181510446 22:23386536-23386558 GAGGAGCCTGGGCCTGGGCAGGG + Intergenic
1181715264 22:24722370-24722392 CAGCAGTGTGGGGCTGGGCACGG - Intronic
1181798673 22:25328839-25328861 AAGAATTTTGGGGCTGGGCACGG + Intergenic
1181967471 22:26667025-26667047 GAGCGTTCTGGGCCTGAGGAGGG - Intergenic
1182900634 22:33895438-33895460 GCTCAGTGTGAGCCTGGGCATGG + Intronic
1183727073 22:39596112-39596134 GAGCAGAGTGAGCCAGGGCAGGG + Intronic
1184200182 22:42963195-42963217 GTACATTGTGGGCCGGGGCAGGG - Intronic
1184647925 22:45906199-45906221 GAGCTCCGTGGGGCTGGGCACGG - Intergenic
1184676074 22:46044237-46044259 GGGCACCGTGGGCCTGGGCCCGG + Intergenic
1184729173 22:46363734-46363756 TAGCATTTTGGGGCTGGCCAGGG + Intronic
949755877 3:7410278-7410300 AAGTATTTTGGGGCTGGGCATGG + Intronic
950143725 3:10633090-10633112 GAGCCATGTGGGCCTGGGAGTGG + Intronic
950474511 3:13207060-13207082 GAGCTTCGTAGACCTGGGCAGGG + Intergenic
950496544 3:13337428-13337450 TAGCTGTGTGGCCCTGGGCACGG + Intronic
951017530 3:17746513-17746535 AATAATTGTGGGGCTGGGCACGG + Intronic
951180709 3:19655091-19655113 GAGCAGTGGGGCCCTGAGCAGGG + Intergenic
952037578 3:29221201-29221223 GAGCCTTGAGGTTCTGGGCATGG - Intergenic
952139133 3:30458952-30458974 GAGCAGTGGGGCCCTGGGCTTGG - Intergenic
952744338 3:36763655-36763677 GAGCCGTGTGACCCTGGGCAAGG + Intergenic
953554393 3:43931955-43931977 TTGCATTATGGGGCTGGGCACGG + Intergenic
954108588 3:48422056-48422078 GAGCATTGTGGGCTTGAGGCTGG + Intronic
955195857 3:56804173-56804195 GATCATTTTAGGGCTGGGCATGG - Intronic
956059246 3:65333173-65333195 GAGCACTCTGGGCCTGGCTAAGG - Intergenic
956889096 3:73592629-73592651 GAGCACTGTGGCACTTGGCATGG + Intronic
957943133 3:87030391-87030413 AATCATTTTGGGCTTGGGCATGG - Intergenic
958024059 3:88029139-88029161 GTTCATTGTGGGCATTGGCATGG + Intergenic
959671345 3:108980906-108980928 GGGCATCGTGGGCATGGGGAGGG + Intronic
959814736 3:110662325-110662347 GAGCAGTGGGGCCCTGGGCCTGG - Intergenic
959873896 3:111359916-111359938 GAGCAGTGTGGTCCTGGGCCTGG - Intronic
960541933 3:118871233-118871255 GAGCAGTGGGGCCCTGGGCCTGG - Intergenic
961197059 3:125011621-125011643 GGGCACTGTGGGGCTTGGCATGG + Intronic
961319827 3:126064754-126064776 GAGCATTGTGTGCATGTGCCGGG - Intronic
961490442 3:127253706-127253728 GAGGAGAGTGGGCCAGGGCAGGG - Intergenic
961593136 3:127995818-127995840 CAGCATTGGGGGACTGGACAGGG + Intergenic
961772741 3:129262121-129262143 GATCCTTCTGGGTCTGGGCACGG + Intronic
962028223 3:131571506-131571528 GAGCATAGTGGACCTGGTCAGGG - Intronic
963112919 3:141701567-141701589 GAGCATGTTGGGCCTGAGAACGG + Intergenic
964638676 3:158885531-158885553 GGGCAATGTGGCCCTGGGCTTGG - Intergenic
965809724 3:172579202-172579224 CAGCAGTGGGGGCCTGGGCCTGG - Intergenic
965857028 3:173101903-173101925 GTGGATTGTGGGTCTGGGCTGGG - Intronic
966428516 3:179807279-179807301 GAGCCTTGGGGGTGTGGGCAAGG - Intronic
966995495 3:185276038-185276060 AAGCAGTTTGGGGCTGGGCATGG - Intronic
968057726 3:195705503-195705525 GAGCCCTGTGGGCCTGGGTGTGG - Intergenic
968521372 4:1036134-1036156 GAGGAGTGAGGGCCGGGGCAGGG - Intergenic
968625293 4:1624160-1624182 TGGCATTGTGGGCATGGGCATGG + Intronic
968695882 4:2026253-2026275 GAGCAGTGGGGCCCCGGGCATGG + Intronic
968840956 4:3005454-3005476 GAGCATAGTGGGGCTGGGGCTGG + Intronic
972844441 4:42970639-42970661 GAGCAGTGGGGCCCTGGGGATGG + Intronic
973010722 4:45069599-45069621 GAGCAGCGTGGCCCTGGGCCTGG - Intergenic
973686797 4:53378104-53378126 GCGCATGGTGGGCGTGGGCCAGG - Intronic
973805172 4:54518786-54518808 CAGTAATTTGGGCCTGGGCACGG + Intergenic
974009273 4:56592619-56592641 GACCCTTGCGGGCCGGGGCAGGG + Intronic
975230202 4:71924023-71924045 GAGCAGTGGGGCCCTGGGCCTGG - Intergenic
975909116 4:79247711-79247733 GTGCATGGTAGTCCTGGGCAGGG - Intronic
977716004 4:100184741-100184763 GAGGATGGTGGGCCTGGAGAGGG - Intergenic
978855197 4:113386568-113386590 GAGCATTGTGGGCAGGGTCTGGG + Intergenic
979242557 4:118461092-118461114 TAGCTATGTGGTCCTGGGCAAGG + Intergenic
979448286 4:120839962-120839984 GAGCAATGTGGGGCTGAGCCCGG - Intronic
979885591 4:126024299-126024321 GAGCAGTGGGGCCCTGGGCCTGG - Intergenic
980800437 4:137741731-137741753 GAGCACTGAGGGCCTAAGCAAGG + Intergenic
981948911 4:150382331-150382353 AACCATTCTGGGGCTGGGCACGG + Intronic
982117276 4:152108068-152108090 GAGCATTGTGAGCCTCAGAAGGG - Intergenic
982609070 4:157551089-157551111 GAGCATTGGGGTTCTGGGCCTGG - Intergenic
984136491 4:175946691-175946713 AAGCACTGTGGGCAAGGGCAGGG + Intronic
984713010 4:182901948-182901970 GGGCAGTGGGGGCCGGGGCAGGG - Intronic
1202764366 4_GL000008v2_random:137605-137627 GATCAGTGTGGGCCTGCTCAGGG - Intergenic
988928811 5:36015608-36015630 GGGCAGTGTGGCCCTGGGCCTGG - Intergenic
989983701 5:50671383-50671405 GAGCCCAGTGGGCCTGGCCATGG + Intronic
990021101 5:51128451-51128473 GAGCAGGGGGGGCCTGGGCCGGG - Intergenic
990439417 5:55829824-55829846 GTGCATTAGGAGCCTGGGCATGG + Intergenic
991208627 5:64078681-64078703 GAGTAATGTGGGGCCGGGCACGG - Intergenic
991674190 5:69075504-69075526 GAGCTGTGTGGGTCGGGGCAGGG + Intergenic
992029773 5:72709440-72709462 GAGCCCTGTGATCCTGGGCAGGG - Intergenic
992130009 5:73682700-73682722 ATGAATTGTGGGGCTGGGCATGG - Intronic
992282610 5:75197190-75197212 AAACATTGTGAGGCTGGGCATGG - Intronic
992969663 5:82043324-82043346 GAGCAGTGGGGCCCTGGGCCTGG + Intronic
993267131 5:85740355-85740377 GAGCACTGGGGCCCTGGGCCTGG + Intergenic
997242612 5:132318852-132318874 GAGCATAGGGGGCCAGGACAGGG + Intronic
997700231 5:135892606-135892628 GAGGATTGTGGGGATGGGAAGGG + Intronic
998563428 5:143193538-143193560 AAGCACTGTAGGCCGGGGCATGG - Intronic
999080454 5:148838527-148838549 GACTATTCTTGGCCTGGGCAAGG + Intergenic
999437184 5:151571883-151571905 GAGCCTTCTAGGCCAGGGCAAGG - Intergenic
1000322530 5:160146180-160146202 GAGTATTATGAGGCTGGGCATGG + Intergenic
1001397289 5:171426467-171426489 CAGCACTGTGGGCCTGAGCATGG + Intronic
1001510295 5:172316027-172316049 GGGCATTGTGGGGGTGTGCAGGG - Intergenic
1001823503 5:174727420-174727442 AAGCACTGTGCGCCTGGGCAGGG - Intronic
1002103840 5:176870219-176870241 GTGCATCGTGGGCCTGGCCCTGG + Intronic
1002109297 5:176897495-176897517 GAGCATAGTGGGAGTAGGCAAGG - Intronic
1002341535 5:178519378-178519400 GCACATTGTGTGCCTGGTCATGG - Intronic
1002537845 5:179887935-179887957 GGGCAGTGTGGGTCTGGGCTAGG + Intronic
1003015269 6:2462791-2462813 GGGCACTGTGGGCCAGCGCAGGG + Intergenic
1003494972 6:6655780-6655802 GAGCATTATGGGCCTAGGCAAGG - Intergenic
1003624228 6:7727603-7727625 GAGCTTTGTGAACCTGGGTAAGG + Exonic
1004622601 6:17344173-17344195 GAGCATGGAGGGGCTAGGCACGG + Intergenic
1005897069 6:30187627-30187649 GAGAAATTTGGGGCTGGGCACGG + Intronic
1006074196 6:31519529-31519551 GAGCACTTTGGGTCTGGGAATGG - Intergenic
1006182774 6:32164011-32164033 GAGCTTTGTGGGCCAGAGCTGGG + Intronic
1006840130 6:37023105-37023127 GTGCATAGTGGGCATGGGCCTGG - Intronic
1007030106 6:38619496-38619518 CAGCATAGTGGACATGGGCAAGG - Intronic
1007721659 6:43888800-43888822 GAGGATGGTGGATCTGGGCATGG - Intergenic
1010536585 6:77038485-77038507 GAGCAGTGGGGCCCTGGGCCTGG - Intergenic
1010610997 6:77953737-77953759 GAGCAATGGGGCCCTGGGCCTGG - Intergenic
1011394043 6:86887470-86887492 GGGCATTGTGAGCCTGTGCTGGG + Intergenic
1012751361 6:103167940-103167962 GAGCAGCGTGGCCCTGGGCCTGG - Intergenic
1015652474 6:135478836-135478858 GAGCAGTGAGGCCCTGGGCCTGG - Intronic
1017436124 6:154417473-154417495 GGGCGATGTGGTCCTGGGCAAGG - Intronic
1019093956 6:169564003-169564025 GAGCATTGTGGGACTTCGCCTGG - Intronic
1019527040 7:1485056-1485078 CAGCAGTGTGGCCCTGGGGAGGG - Intronic
1019587965 7:1815075-1815097 GCGAACTGTGGGCCTGGGCCAGG - Intergenic
1020094699 7:5361843-5361865 GGGCCTGGTGGGCCGGGGCAGGG + Intronic
1021574372 7:22094082-22094104 CGGCATTGGGGGCCAGGGCATGG - Intergenic
1022333251 7:29399669-29399691 CACCATTGTGGGCCTGGGAAGGG - Intronic
1022706028 7:32802669-32802691 GAGCAGTGGGGCCCTGGGCCTGG + Intergenic
1022800373 7:33771295-33771317 GAGCATTGAAGACCTGGGCTTGG - Intergenic
1023265441 7:38400366-38400388 AAGCAATGAGGGGCTGGGCACGG - Intronic
1024173238 7:46811460-46811482 GAGCAAGGTGGGCATGGGGAGGG - Intergenic
1026015535 7:66668385-66668407 TAGGATAGTGGGGCTGGGCATGG - Intronic
1026134343 7:67646428-67646450 GAGCATTGGAGGCCTGGGAGAGG - Intergenic
1026961192 7:74408740-74408762 TAACATTTTGGGGCTGGGCATGG - Intergenic
1026967035 7:74446668-74446690 AAACATTTTGGGGCTGGGCATGG + Intergenic
1027364891 7:77447160-77447182 GAGCCTTGTGGGTTTGGTCAGGG - Intergenic
1027426130 7:78062897-78062919 GAGGACTGTGGCCCTGGGCTGGG - Intronic
1030115114 7:106057055-106057077 GGGCAGTGTGGACCTGAGCATGG + Intergenic
1030257011 7:107521211-107521233 GACCATTCAGGGCATGGGCATGG + Intronic
1030280629 7:107770991-107771013 GAGCATTATAGGGATGGGCAAGG + Intronic
1030420575 7:109302278-109302300 CAGCATTGTGGACATGGGCAAGG - Intergenic
1030675799 7:112384319-112384341 GAGCATGGCTGGCTTGGGCAAGG - Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1034954570 7:155326713-155326735 GTGTTTTGTGGGGCTGGGCAGGG - Intergenic
1035235288 7:157493944-157493966 GAGCATAGGGGGCCTGGGCTGGG - Intergenic
1035417197 7:158699602-158699624 GAGCACGGTGGGCCTGGGGAGGG - Intronic
1036203798 8:6790953-6790975 GAGTGTGGTGAGCCTGGGCAGGG + Intergenic
1036495792 8:9268732-9268754 GAGAATTGTGAGCATAGGCATGG + Intergenic
1038433862 8:27521032-27521054 GGGCAGAGTGGGCATGGGCAGGG + Intronic
1038616908 8:29103942-29103964 GCTCATTGTGTGCCTGTGCAAGG - Intronic
1039778828 8:40763518-40763540 GAGCATTGTTGTTCTGGGCAGGG - Intronic
1040502597 8:48018125-48018147 GGGCATTGTGCAGCTGGGCATGG - Intronic
1040644971 8:49387806-49387828 GAGCAGGGTGGCCCTGGGCCAGG - Intergenic
1041659863 8:60391196-60391218 CAGCTTTGTGGGCCAGGACAGGG + Intergenic
1042550564 8:69990786-69990808 GATCAGTGTGTGGCTGGGCATGG + Intergenic
1042650162 8:71032002-71032024 AAACACTGTGGGGCTGGGCACGG + Intergenic
1043201218 8:77372314-77372336 GAGCAGTGGGGTCCTGGGCCTGG - Intergenic
1043484101 8:80681963-80681985 CAGCATTGTCAGCCAGGGCAGGG - Intronic
1047207781 8:122817473-122817495 GTGCCTTGTGGGCCTGGGGTTGG - Intronic
1047917923 8:129603074-129603096 GAGCAGGGTTGCCCTGGGCATGG + Intergenic
1047918086 8:129604060-129604082 GAGCAGGGTGGCCCTGGGCATGG + Intergenic
1048043357 8:130751348-130751370 GAGCAATGGGGACCTGGGCATGG + Intergenic
1048213407 8:132475941-132475963 GAGCAGTGGGGCCCTGGGCCTGG - Intronic
1048463322 8:134640861-134640883 GAGAATCTTGGGACTGGGCAAGG + Intronic
1049471310 8:142776168-142776190 GACCCATGGGGGCCTGGGCAGGG + Intronic
1049487646 8:142874874-142874896 GAGCAATGTGGGACTGGCCTCGG - Intronic
1050317554 9:4418858-4418880 GAGCAATGTGAGCCAGGACAGGG + Intergenic
1050402429 9:5270653-5270675 GAGCAGTGGGGCCCTGGGCCTGG - Intergenic
1050537810 9:6645516-6645538 GACCCTTGCGGGCCGGGGCAGGG - Exonic
1051361166 9:16282941-16282963 AAGCGTTGTGGATCTGGGCAGGG - Intergenic
1055503383 9:76924164-76924186 GAGCAATGTGGCCATGAGCAAGG + Intergenic
1056743012 9:89276216-89276238 GAGCAGTGTGTACCTGGGCCTGG + Intergenic
1057208726 9:93188043-93188065 TAGCATTCTGGGCATGGGGAGGG + Intronic
1059110812 9:111556966-111556988 GAGCAGTGTGACCCTGGGCCTGG + Intronic
1060158641 9:121338942-121338964 GTGCTTTGTGGGCCAGGGGAAGG - Intergenic
1060174634 9:121488422-121488444 AAGGATATTGGGCCTGGGCATGG + Intergenic
1060175725 9:121496326-121496348 GACCATTATGGGCCAGGGCTTGG - Intergenic
1060273242 9:122162814-122162836 GAGGATTGTGGGCAGGGGCAAGG + Intronic
1060802133 9:126551476-126551498 GTGCATAGTGGGGCTGGGCGTGG - Intergenic
1061499789 9:130995261-130995283 GAGCAGAGTGGTCCTGGGCAAGG + Intergenic
1061613757 9:131765838-131765860 CAGCCTTGGGGGCCAGGGCAAGG - Intergenic
1061635204 9:131903555-131903577 GAGCAGAGTGGCCCTGGGAAAGG + Intronic
1061742490 9:132717107-132717129 GAACATTTAGGGGCTGGGCATGG + Intergenic
1061873588 9:133533247-133533269 GGGCAGTGTGGGCCTGGGTTAGG + Intronic
1062052970 9:134456962-134456984 GAGCCCTGAGGGCCTGGCCATGG - Intergenic
1062078187 9:134603583-134603605 GGGCATCGTGGGCCAGCGCAAGG + Intergenic
1062386131 9:136312196-136312218 GGGCACTTTGGGCCTGGCCAGGG + Intergenic
1062435228 9:136544090-136544112 GAGCATCGCGGGCCTAGGCAGGG + Exonic
1062600912 9:137318265-137318287 AAGCCCTGTGGGGCTGGGCAGGG - Intronic
1203545117 Un_KI270743v1:122492-122514 GATCAGTGTGGGCCTGCTCAGGG - Intergenic
1203575042 Un_KI270745v1:938-960 GAGCATGGTGGGAATGGGGACGG + Intergenic
1185473679 X:400346-400368 GCGCCTTGTGGGTGTGGGCAGGG + Intergenic
1187162957 X:16781300-16781322 AAGCAATGTGGGGCTGGGCACGG - Intergenic
1188541549 X:31256064-31256086 GAGGATATTGGGGCTGGGCACGG - Intronic
1188815412 X:34706333-34706355 GAGCATCTTGGACCTGGGGAAGG - Intergenic
1189443830 X:41062119-41062141 CTCCATTGTGGGGCTGGGCACGG + Intergenic
1189857811 X:45240828-45240850 GAGCATAGTGACCCTGGGTAGGG + Intergenic
1190484723 X:50913072-50913094 GAGCATTGTGGGAAATGGCAGGG + Intronic
1193489729 X:82134212-82134234 GAGCAGTGGGGCCCTGGGCATGG + Intergenic
1193514938 X:82451815-82451837 GAGCATGGTAGCCCTGTGCAGGG - Intergenic
1194505646 X:94730258-94730280 GAGCAGTGGGGCCCTGGGCCTGG + Intergenic
1195427201 X:104747689-104747711 GAGCATTGGAGGCATGGGAATGG + Intronic
1195472899 X:105253080-105253102 GAGCAGACTGGGTCTGGGCAAGG - Intronic
1196127297 X:112113714-112113736 CAGCATAGTGGGCAAGGGCAAGG + Intergenic
1197757900 X:130009172-130009194 GAGCACAGTGTGGCTGGGCACGG + Intronic
1198274639 X:135089321-135089343 GAGCAGGGTGGCCCTGGGCCTGG - Intergenic
1198316678 X:135474324-135474346 GAGAAATGAGGGCCTGGGCTAGG + Intergenic
1198790744 X:140342827-140342849 GATTACTGTGGGCCTGGGCATGG + Intergenic
1199139196 X:144289929-144289951 GAGCAGTGGGGCCCTGGGCCTGG - Intergenic
1199737027 X:150694008-150694030 GAGGATTGGTGGCCTGGGCAGGG - Intronic
1200141521 X:153905129-153905151 GAGCATGGTGGGGCTGGGGCAGG - Exonic
1201311998 Y:12605638-12605660 CAGCATTGTGGACATGGACAAGG + Intergenic
1202192557 Y:22259821-22259843 CAGCATAGTGGACATGGGCAAGG + Intergenic