ID: 1172170171

View in Genome Browser
Species Human (GRCh38)
Location 20:32925521-32925543
Sequence TTTTGGGTTTTTAGTGGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375311
Summary {0: 2, 1: 313, 2: 14397, 3: 214373, 4: 146226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172170165_1172170171 -6 Left 1172170165 20:32925504-32925526 CCACCACGCCTAGCTAATTTTGG 0: 4
1: 1208
2: 42222
3: 170936
4: 238190
Right 1172170171 20:32925521-32925543 TTTTGGGTTTTTAGTGGAGACGG 0: 2
1: 313
2: 14397
3: 214373
4: 146226
1172170164_1172170171 21 Left 1172170164 20:32925477-32925499 CCAAAGTGCTGGCATTACAGGCG 0: 924
1: 128663
2: 278616
3: 223588
4: 150451
Right 1172170171 20:32925521-32925543 TTTTGGGTTTTTAGTGGAGACGG 0: 2
1: 313
2: 14397
3: 214373
4: 146226
1172170168_1172170171 -9 Left 1172170168 20:32925507-32925529 CCACGCCTAGCTAATTTTGGGTT 0: 1
1: 11
2: 467
3: 10536
4: 87469
Right 1172170171 20:32925521-32925543 TTTTGGGTTTTTAGTGGAGACGG 0: 2
1: 313
2: 14397
3: 214373
4: 146226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172170171 Original CRISPR TTTTGGGTTTTTAGTGGAGA CGG Intronic
Too many off-targets to display for this crispr