ID: 1172172487

View in Genome Browser
Species Human (GRCh38)
Location 20:32947692-32947714
Sequence CCCGTTACTACTGTTTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172172487_1172172490 11 Left 1172172487 20:32947692-32947714 CCACAAAAAACAGTAGTAACGGG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1172172490 20:32947726-32947748 CACTAAATGCCTATATTAGAAGG 0: 1
1: 1
2: 3
3: 31
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172172487 Original CRISPR CCCGTTACTACTGTTTTTTG TGG (reversed) Intronic
911221318 1:95250458-95250480 CCAGTTACTACTGTTCTTATTGG + Intergenic
915830681 1:159126952-159126974 CCCTTTACCATTGTGTTTTGAGG - Intronic
919327201 1:196123842-196123864 TCCGTGCTTACTGTTTTTTGGGG - Intergenic
1064680704 10:17808669-17808691 TCCTTTACCACTGTTTTTTCTGG + Intergenic
1076632945 10:131862836-131862858 CCTGTATATACTGTTTTTTGGGG + Intergenic
1080162059 11:29188819-29188841 TCCATTATTACTGTTTTTTGGGG - Intergenic
1082051133 11:47771236-47771258 ACCGGTACTAATGTATTTTGTGG - Intergenic
1083823520 11:65185519-65185541 CCCTGTAATACTGTCTTTTGTGG - Intronic
1090079121 11:123599472-123599494 CTCGTTGTTGCTGTTTTTTGAGG + Intronic
1091067459 11:132529515-132529537 CCCATGTCTACTGTTTTTAGTGG + Intronic
1093852256 12:24054898-24054920 CCAGTTACAACTGTTATTTGTGG + Intergenic
1107183968 13:37495646-37495668 CCCTTCATTACTGTCTTTTGGGG + Intergenic
1107330441 13:39294580-39294602 CCCCAAACCACTGTTTTTTGGGG + Intergenic
1109920774 13:69055025-69055047 CAGTTTACTAGTGTTTTTTGAGG - Intergenic
1111147363 13:84201380-84201402 CCCTTTATTATTATTTTTTGGGG - Intergenic
1111977662 13:94983706-94983728 CCTGTTACTATTATTGTTTGTGG + Intergenic
1114147888 14:19999091-19999113 TACATTACTACAGTTTTTTGGGG + Intergenic
1122221893 14:100244582-100244604 CCCCTTACTTTTTTTTTTTGAGG + Intronic
1122687510 14:103516906-103516928 ACAGTGACTACTGTTCTTTGGGG + Intergenic
1135504860 16:23027581-23027603 CCTGGTACTCATGTTTTTTGAGG + Intergenic
1139324657 16:66142949-66142971 CTCCTTTCTTCTGTTTTTTGGGG - Intergenic
1152885025 17:82844694-82844716 TCCGTTTCTGCTGTTTTTAGTGG + Intronic
1154273242 18:12937832-12937854 CCCTTCACCACTGTTTCTTGGGG + Intergenic
1154500635 18:14995444-14995466 CCCTTTCATACTGTTTCTTGAGG - Intergenic
1156659201 18:39326696-39326718 CCCCTTACAACTTTTTATTGTGG + Intergenic
1162197130 19:8993562-8993584 CCTGTTACTGTTTTTTTTTGGGG + Intergenic
1165560160 19:36672124-36672146 CCCTTCACCACTGTTCTTTGGGG - Intergenic
1165678235 19:37747007-37747029 CCTGATCCTTCTGTTTTTTGAGG - Intronic
925841021 2:7992213-7992235 CCAGTTACTAAGGATTTTTGTGG + Intergenic
934331520 2:92073755-92073777 CCCGTTGCTGCGGGTTTTTGTGG + Intergenic
936456923 2:112682328-112682350 CCCGTGACAAATGTTTTTTCTGG - Intergenic
938499832 2:131825772-131825794 CCCTTTCATACTGTTTCTTGAGG - Intergenic
939994053 2:148903488-148903510 ACCCTTACTGCTGTTTTTAGTGG + Intronic
944826991 2:203494021-203494043 TCTGTTAATACTGTATTTTGGGG - Intronic
1172172487 20:32947692-32947714 CCCGTTACTACTGTTTTTTGTGG - Intronic
1172612512 20:36262403-36262425 CCCTCAACTCCTGTTTTTTGGGG - Intronic
1174336262 20:49863130-49863152 CCAGTTTCTCCTGTTTTTTAAGG + Intronic
1178008230 21:28248624-28248646 ACAGTTACCACTGTTTTGTGTGG - Intergenic
1181785916 22:25226973-25226995 CCCTTGACAACTGTTTTTTAAGG + Intronic
949283908 3:2378865-2378887 CCCTTTACTACTGGTATTAGAGG + Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
957830814 3:85515846-85515868 CCTATTACTACTGATTTATGAGG + Intronic
960581730 3:119285452-119285474 CGGGTTGCTACTATTTTTTGAGG + Intergenic
964264067 3:154874642-154874664 CCCATTACTTCTGCTTTTTGTGG - Intergenic
977061926 4:92270513-92270535 CCCGCTGCTCCAGTTTTTTGAGG - Intergenic
978292110 4:107153452-107153474 CCCTTTTCTACTGTTCTATGAGG - Intronic
981787125 4:148492065-148492087 CCTGATACTTCTTTTTTTTGGGG + Intergenic
982632086 4:157843470-157843492 CCAGTTACTACTGATTACTGTGG - Intergenic
986403915 5:7406571-7406593 CCCTTTTCTTCTGTTTTATGTGG + Intronic
994883782 5:105531057-105531079 CCAGTTTCTATTGTTTTGTGGGG + Intergenic
996010445 5:118476593-118476615 CCCATTATGACTGTTTTATGGGG + Intergenic
999570234 5:152911967-152911989 CCAGTTTCTACTCTGTTTTGGGG + Intergenic
1001791873 5:174464651-174464673 CCCATAACTACTTTTATTTGTGG - Intergenic
1002117432 5:176974055-176974077 TTTATTACTACTGTTTTTTGAGG - Intronic
1004255974 6:14064813-14064835 CCCCTTACTACAGTTCTGTGAGG + Intergenic
1014769143 6:125441627-125441649 CCTGTTTCTTCTGTTTTCTGTGG - Intergenic
1016866052 6:148767932-148767954 CCCATTTCTAGTTTTTTTTGTGG + Intronic
1017133232 6:151126057-151126079 CCCTTTCATACTGTTTCTTGAGG - Intergenic
1023792565 7:43764774-43764796 CACTTTACTTCTTTTTTTTGCGG - Intronic
1031190120 7:118538286-118538308 CCCTCTCCTTCTGTTTTTTGGGG + Intergenic
1032925135 7:136595706-136595728 CCAGTTAATTCTGTTATTTGCGG - Intergenic
1035441578 7:158906182-158906204 ATTTTTACTACTGTTTTTTGGGG + Intronic
1037501768 8:19493278-19493300 CCAGTTTCCACTCTTTTTTGGGG + Intronic
1038564496 8:28608392-28608414 CACTTTACTACTAGTTTTTGTGG + Intronic
1041258693 8:56001445-56001467 CCCATCACTACTGTTTCATGTGG + Intronic
1044907128 8:97017079-97017101 CCCACTTCTACAGTTTTTTGGGG - Intronic
1046961193 8:120114944-120114966 TCAGTTTTTACTGTTTTTTGGGG + Intronic
1051652314 9:19340807-19340829 CCTGTTTCTACTGTTCTTTGCGG + Intronic
1052169325 9:25374477-25374499 CCCATCATTACTGTGTTTTGTGG - Intergenic
1055972949 9:81929976-81929998 CCCTTTTCTACTGATTCTTGGGG + Intergenic
1055974702 9:81945048-81945070 CCCTTTTCTACTGATTCTTGGGG + Intergenic
1055979738 9:81990301-81990323 CCCTTTTCTACTGATTCTTGGGG + Intronic
1056242334 9:84660466-84660488 CCCGTGACTCCAGTTTTCTGAGG + Intergenic
1202803589 9_KI270720v1_random:26418-26440 CACATTACAAATGTTTTTTGTGG - Intergenic
1188131842 X:26445445-26445467 CTGGTTTCTAATGTTTTTTGTGG + Intergenic
1188245232 X:27830469-27830491 CCCTTTACTCCTGTTCTTTCAGG - Intergenic
1190727954 X:53203722-53203744 CAAGTTGCTTCTGTTTTTTGGGG + Intronic
1201925423 Y:19281188-19281210 CTGGTTACTAATGTTTTGTGAGG + Intergenic