ID: 1172174522

View in Genome Browser
Species Human (GRCh38)
Location 20:32964139-32964161
Sequence CGCTGGAGCCTGGGGAGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172174522_1172174533 18 Left 1172174522 20:32964139-32964161 CCTCAACTCCCCAGGCTCCAGCG No data
Right 1172174533 20:32964180-32964202 TCCCAGGTAGCTGAGACCACAGG 0: 26
1: 760
2: 10074
3: 68436
4: 184830
1172174522_1172174528 2 Left 1172174522 20:32964139-32964161 CCTCAACTCCCCAGGCTCCAGCG No data
Right 1172174528 20:32964164-32964186 CCTCCCCGCCTCAGCTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172174522 Original CRISPR CGCTGGAGCCTGGGGAGTTG AGG (reversed) Intergenic
No off target data available for this crispr