ID: 1172175096

View in Genome Browser
Species Human (GRCh38)
Location 20:32967420-32967442
Sequence GCACCTGAGGCAAATCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172175096_1172175101 3 Left 1172175096 20:32967420-32967442 CCCTGGAGATTTGCCTCAGGTGC No data
Right 1172175101 20:32967446-32967468 AGCCCACAGGCCATCCCTCCAGG No data
1172175096_1172175099 -10 Left 1172175096 20:32967420-32967442 CCCTGGAGATTTGCCTCAGGTGC No data
Right 1172175099 20:32967433-32967455 CCTCAGGTGCCACAGCCCACAGG No data
1172175096_1172175104 10 Left 1172175096 20:32967420-32967442 CCCTGGAGATTTGCCTCAGGTGC No data
Right 1172175104 20:32967453-32967475 AGGCCATCCCTCCAGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172175096 Original CRISPR GCACCTGAGGCAAATCTCCA GGG (reversed) Intergenic
No off target data available for this crispr