ID: 1172177322

View in Genome Browser
Species Human (GRCh38)
Location 20:32980294-32980316
Sequence CACCCACAGGGCCGCCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172177322_1172177328 10 Left 1172177322 20:32980294-32980316 CCACTCTGGCGGCCCTGTGGGTG No data
Right 1172177328 20:32980327-32980349 TGCACCTCTGGTTCTTGTCTTGG No data
1172177322_1172177330 19 Left 1172177322 20:32980294-32980316 CCACTCTGGCGGCCCTGTGGGTG No data
Right 1172177330 20:32980336-32980358 GGTTCTTGTCTTGGTCGCCTTGG No data
1172177322_1172177327 -2 Left 1172177322 20:32980294-32980316 CCACTCTGGCGGCCCTGTGGGTG No data
Right 1172177327 20:32980315-32980337 TGGTTGGCACTCTGCACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172177322 Original CRISPR CACCCACAGGGCCGCCAGAG TGG (reversed) Intergenic
No off target data available for this crispr