ID: 1172184087

View in Genome Browser
Species Human (GRCh38)
Location 20:33020606-33020628
Sequence CCCAGGACGGGGGTTTCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172184087_1172184098 0 Left 1172184087 20:33020606-33020628 CCTCTAGAAACCCCCGTCCTGGG 0: 1
1: 0
2: 2
3: 6
4: 84
Right 1172184098 20:33020629-33020651 TAGGGCACACCTTGAGCCTGGGG 0: 1
1: 0
2: 2
3: 13
4: 165
1172184087_1172184096 -2 Left 1172184087 20:33020606-33020628 CCTCTAGAAACCCCCGTCCTGGG 0: 1
1: 0
2: 2
3: 6
4: 84
Right 1172184096 20:33020627-33020649 GGTAGGGCACACCTTGAGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 134
1172184087_1172184100 9 Left 1172184087 20:33020606-33020628 CCTCTAGAAACCCCCGTCCTGGG 0: 1
1: 0
2: 2
3: 6
4: 84
Right 1172184100 20:33020638-33020660 CCTTGAGCCTGGGGAAGAGATGG 0: 1
1: 0
2: 3
3: 88
4: 960
1172184087_1172184097 -1 Left 1172184087 20:33020606-33020628 CCTCTAGAAACCCCCGTCCTGGG 0: 1
1: 0
2: 2
3: 6
4: 84
Right 1172184097 20:33020628-33020650 GTAGGGCACACCTTGAGCCTGGG 0: 1
1: 0
2: 1
3: 7
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172184087 Original CRISPR CCCAGGACGGGGGTTTCTAG AGG (reversed) Intronic
900381414 1:2385880-2385902 TCCAGGACACGGGTTTCTGGTGG - Exonic
901437268 1:9255205-9255227 CCCAGGAGTGGGGTTGCTGGAGG + Intronic
902483679 1:16727263-16727285 CCCAGGCCGTGGGTGTGTAGAGG + Intergenic
905484926 1:38288867-38288889 CCCTGGAAAGGGGTTTCTAATGG + Intergenic
905730705 1:40297423-40297445 CGCAGGAGGGGGGATTCTGGAGG + Intergenic
906127637 1:43437302-43437324 CCCAGCATGGGGGTCTCTCGGGG + Exonic
907640039 1:56179477-56179499 CCCAGGACTGTGGTTTCCAAAGG - Intergenic
908501030 1:64744644-64744666 CCCAGCGCGGGAGTTTCGAGGGG + Intergenic
922739623 1:228007789-228007811 CCGGGCACGGGGGTTTCCAGGGG + Intronic
1069807373 10:71134360-71134382 CTCAGGAAGGGGGTTGCCAGTGG - Intergenic
1070523704 10:77276678-77276700 CCCAGGGAGTGGGTTTCTAAAGG + Intronic
1070684360 10:78469899-78469921 CCCAGCACAGGGTTTTCTAAAGG + Intergenic
1070770971 10:79082188-79082210 CCCAGGACGAGTGTTTCTGGTGG - Intronic
1076212246 10:128658002-128658024 CCCAGGTTGGGGCTTTCGAGAGG - Intergenic
1077090970 11:777951-777973 CCCAGGACGGGGGCGTCGCGGGG + Intronic
1078150070 11:8750889-8750911 TCCAGGCCAGGGGTTTCTTGGGG - Intronic
1096576969 12:52558926-52558948 GCCAGGAGGGGGGCTTCTGGGGG - Intergenic
1103607255 12:122096549-122096571 CCCAGGACAGGTGTGTCTAGGGG + Intronic
1104456832 12:128921651-128921673 CCCAGGACGGGGGTAGTTGGAGG + Intronic
1105932707 13:25067691-25067713 CCCAGGCTGTGGGTGTCTAGAGG - Intergenic
1112306604 13:98280209-98280231 CCCAGGAGGCTGTTTTCTAGGGG - Intronic
1114241779 14:20874716-20874738 CCCAGGTCGTGGGTCCCTAGAGG - Intergenic
1114248370 14:20935282-20935304 CCCAGGTCGTGGGTCCCTAGAGG - Intergenic
1120400259 14:84022529-84022551 CCCAGGAATGGGGTTTCCTGTGG + Intergenic
1122635653 14:103128477-103128499 CCCAGGGCGGGGGAGTCCAGGGG + Intronic
1125694075 15:41621110-41621132 CCAAGGACCGGGCTTTCAAGGGG + Intergenic
1126539694 15:49808242-49808264 CCCAGGAGAAGGGTTTCTAGAGG - Intergenic
1137888522 16:52132696-52132718 CCCAGGGCTGGGGTTTGGAGAGG + Intergenic
1141645636 16:85366031-85366053 CCCAGGGCCAGGGTTTCTGGTGG - Intergenic
1142238008 16:88931722-88931744 CCCAGGACTGGGGTGACCAGAGG - Intronic
1144959846 17:19038869-19038891 CCCAGGGCGGGAGTTTCCTGAGG + Intronic
1144975314 17:19135655-19135677 CCCAGGGCGGGAGTTTCCTGAGG - Intronic
1145235077 17:21202492-21202514 TCCAGGACCGGGGTTTCCACTGG - Intronic
1149555638 17:57571447-57571469 CCCAGGAGATGGGTTTCTGGTGG + Intronic
1153051929 18:908189-908211 CCCAACAAGGGGGTCTCTAGCGG + Intronic
1154142128 18:11833499-11833521 CTCAGGGCAAGGGTTTCTAGAGG - Intronic
1160093225 18:75846468-75846490 CCCAGGGCGGGGCTGTCTGGAGG - Intergenic
1161772161 19:6236735-6236757 CCCAGGAGGCTGGTTTCCAGGGG - Intronic
1164415597 19:28044486-28044508 GCCTGGGCGGGGGTCTCTAGAGG + Intergenic
925132557 2:1503871-1503893 CCCAGAACGGGGGTCGCTCGCGG + Intronic
927944639 2:27128231-27128253 TCCAGGACTGGGTTTTTTAGGGG + Intronic
932229191 2:70068466-70068488 TGGAGAACGGGGGTTTCTAGGGG + Intergenic
933776546 2:85774481-85774503 CCCAGGATAAGTGTTTCTAGAGG + Intronic
937330899 2:121028694-121028716 CCCAGGAGGGGAGTTTCTAGTGG + Intergenic
1172184087 20:33020606-33020628 CCCAGGACGGGGGTTTCTAGAGG - Intronic
1172624727 20:36340544-36340566 CCCAGGTCGGGGGTCTCTGCTGG + Intronic
1173941658 20:46915846-46915868 CCCAGGTCCGGGGGTACTAGAGG - Intronic
1175723949 20:61304071-61304093 CCCAGGACACGGGTTCCTTGAGG - Intronic
1175928111 20:62480740-62480762 CCCAGGACTGGGATTGATAGGGG - Intergenic
1176205942 20:63888195-63888217 CCCAGGCCCGGGGACTCTAGAGG - Intronic
1184672446 22:46022037-46022059 CTCCTGACGGGGGTTTCTGGGGG - Intergenic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1184797996 22:46742862-46742884 ACCAGGATGGGGGCTTCTTGGGG - Intergenic
950660672 3:14465026-14465048 CCCAGGACGGTGGTTTACAGTGG - Intronic
957903644 3:86531075-86531097 CTCAGGACGGGGGGGTCCAGAGG - Intergenic
961041804 3:123683228-123683250 CCCAGGGAGGGGGCTTCAAGGGG - Intronic
961594274 3:128004867-128004889 CCCAGGACGGGGCTGGGTAGAGG - Intergenic
966346690 3:178988805-178988827 CCCAGGAAGGTGGTTTGTGGGGG - Intergenic
967224450 3:187277259-187277281 CCCAGGACTGTGCTTTCTACTGG + Intronic
968753692 4:2403481-2403503 CCCAGGCCTGTGGTTTCGAGGGG + Intronic
974343692 4:60649624-60649646 CACAGGAAGGGAGTTTCTAAAGG - Intergenic
984461461 4:180041836-180041858 AACAGGACTGGGGTTACTAGGGG + Intergenic
985519699 5:367803-367825 CCCAGGACAGGGGTTGGCAGTGG + Intronic
992188121 5:74263595-74263617 ACCAGGACAGGGGTTTCTAGGGG - Intergenic
996534840 5:124567050-124567072 CCCAGCACAGTGGTTTGTAGAGG + Intergenic
998458969 5:142295419-142295441 CCAGGGATGGGGGTTTCAAGGGG - Intergenic
1001848560 5:174942739-174942761 CCCAGGAGGGGGGGTTGCAGTGG - Intergenic
1007825156 6:44594745-44594767 CCCAGGACGGCAGCTGCTAGGGG - Intergenic
1026086538 7:67267671-67267693 CCCATGACTGGGGTGTATAGGGG - Intergenic
1026496597 7:70908899-70908921 GCCAGGATGGGAGTTTCTGGAGG + Intergenic
1032075003 7:128832015-128832037 CCCAGGAGGGGAGTTTCATGTGG + Intronic
1032461526 7:132114831-132114853 CACAGGAAGTGGGTTTCTAATGG + Intergenic
1036190892 8:6669835-6669857 TCCAGGACGGGGGCTGCTAGTGG + Intergenic
1036556416 8:9863843-9863865 CCCAGGACGCAGATTTCTACAGG - Intergenic
1036600934 8:10259685-10259707 CCCAGGACTAGGGTTTCCTGGGG + Intronic
1037846554 8:22287807-22287829 CCCAGGACTGGTGTTTTGAGGGG + Intronic
1037907362 8:22723450-22723472 CCCAGGGCGGGAGTCTCTCGGGG - Intronic
1038493037 8:27983485-27983507 CCCAGGATGGGGATTTCACGGGG - Intronic
1049140067 8:140946086-140946108 TCCAGGAGGGGTGTGTCTAGGGG + Intronic
1049575187 8:143386580-143386602 CCCAGGACGGGGGTGCCGAGTGG + Intergenic
1051180963 9:14411720-14411742 ACCAGGATGGGGGTTTATTGGGG - Intergenic
1056133155 9:83605184-83605206 GCCAGGACTGGGGTTTTGAGAGG - Intergenic
1056823185 9:89858925-89858947 CTCAGGATGGTGGTTGCTAGGGG + Intergenic
1057695278 9:97318602-97318624 CCCAGGAGGGGTGCTTCTTGGGG + Intronic
1057836474 9:98449376-98449398 CCCAGTGCGGGGCTTGCTAGAGG + Intronic
1060723791 9:125994659-125994681 CTCAGGACTTGGCTTTCTAGGGG + Intergenic
1061039770 9:128133358-128133380 CTCAGGATGGTGGTTGCTAGGGG - Intergenic
1061393089 9:130328349-130328371 GCTAGGACCGGGCTTTCTAGGGG - Intronic
1061448644 9:130656511-130656533 CTCAGGACTGGGGCTTCTGGAGG - Intergenic
1062627494 9:137449871-137449893 TCCACGTCGGGGGTTTCCAGAGG + Intronic
1186125095 X:6404820-6404842 CCCAGAACTTGGCTTTCTAGGGG - Intergenic
1187518103 X:19990822-19990844 CCCAGGAGGGGCGGTTCTCGGGG - Intergenic
1189480638 X:41389850-41389872 CCCAGGGCAGAGCTTTCTAGGGG - Intergenic