ID: 1172184423

View in Genome Browser
Species Human (GRCh38)
Location 20:33022444-33022466
Sequence ATCGTTCCTTCTCATGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172184423_1172184432 5 Left 1172184423 20:33022444-33022466 CCGCCCCCATGAGAAGGAACGAT 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1172184432 20:33022472-33022494 CACAGAGGAGCAGGGCTCTGTGG No data
1172184423_1172184430 -4 Left 1172184423 20:33022444-33022466 CCGCCCCCATGAGAAGGAACGAT 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1172184430 20:33022463-33022485 CGATTGGTACACAGAGGAGCAGG 0: 1
1: 0
2: 2
3: 66
4: 2707
1172184423_1172184433 6 Left 1172184423 20:33022444-33022466 CCGCCCCCATGAGAAGGAACGAT 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1172184433 20:33022473-33022495 ACAGAGGAGCAGGGCTCTGTGGG 0: 1
1: 0
2: 4
3: 35
4: 296
1172184423_1172184431 -3 Left 1172184423 20:33022444-33022466 CCGCCCCCATGAGAAGGAACGAT 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1172184431 20:33022464-33022486 GATTGGTACACAGAGGAGCAGGG 0: 1
1: 0
2: 2
3: 16
4: 178
1172184423_1172184434 7 Left 1172184423 20:33022444-33022466 CCGCCCCCATGAGAAGGAACGAT 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1172184434 20:33022474-33022496 CAGAGGAGCAGGGCTCTGTGGGG 0: 1
1: 0
2: 6
3: 58
4: 449
1172184423_1172184429 -10 Left 1172184423 20:33022444-33022466 CCGCCCCCATGAGAAGGAACGAT 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1172184429 20:33022457-33022479 AAGGAACGATTGGTACACAGAGG 0: 1
1: 0
2: 0
3: 4
4: 96
1172184423_1172184435 18 Left 1172184423 20:33022444-33022466 CCGCCCCCATGAGAAGGAACGAT 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1172184435 20:33022485-33022507 GGCTCTGTGGGGATTTCCCTAGG 0: 1
1: 1
2: 2
3: 14
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172184423 Original CRISPR ATCGTTCCTTCTCATGGGGG CGG (reversed) Intronic
900363806 1:2302369-2302391 ATGTTTCCTTCCCATGGGGAGGG + Intronic
902379109 1:16044384-16044406 ATCTTTCCTCTTCATGGGTGGGG + Intronic
905583286 1:39098421-39098443 ACTGTTCCTTGTAATGGGGGAGG - Intronic
908419859 1:63949326-63949348 ACCTTTCCTTCTCTGGGGGGTGG - Intronic
917096580 1:171404455-171404477 CTTGTTCCTTCTCATTTGGGAGG - Intergenic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
918319333 1:183349863-183349885 AGCTTTCCTTCTCAGAGGGGTGG - Intronic
918384467 1:183991671-183991693 GTGGTTCCTTCACATGGCGGTGG + Intronic
919406947 1:197197150-197197172 ATAGTACCTTCTCATGGGGTAGG - Intronic
922718331 1:227888100-227888122 AGCCTTCCTACTCATGGGGAGGG + Intergenic
924834880 1:247638178-247638200 ATCCTTCCTGCTCATGGGGAAGG - Intergenic
1068930062 10:62580659-62580681 ATCTTGCCATCTCATGGGGATGG + Intronic
1069903266 10:71718076-71718098 GTCTTTCCTTTTCATGAGGGTGG + Intronic
1070427941 10:76307611-76307633 AGGGTTCTTTCTCATGGGTGAGG + Intronic
1079249782 11:18779033-18779055 AAGGCTCCTTCTCATGGGGCTGG + Intronic
1079361156 11:19771590-19771612 TTTCTTCCTTCTAATGGGGGGGG - Intronic
1079606380 11:22373583-22373605 ATTTTTCCTTCTCATGGCAGTGG + Intronic
1083725590 11:64626342-64626364 ATTGTCCCTTCACTTGGGGGTGG + Intronic
1085020505 11:73204049-73204071 AACCTTCCTTCTCCTGAGGGTGG + Intergenic
1085447645 11:76611195-76611217 CCAGTTCCTTCTCATGGGGCAGG + Intergenic
1086167006 11:83790803-83790825 GTGGTTCCTTCTCAAGTGGGAGG - Intronic
1086306415 11:85485464-85485486 CTGGTTCCTTTTCATGGAGGAGG - Intronic
1088905301 11:114150988-114151010 AGTGTTGGTTCTCATGGGGGCGG + Intronic
1090682732 11:129078343-129078365 CTGGTTCCTTCTCATTTGGGTGG - Intronic
1101507002 12:105356171-105356193 ATGGTTCCTGCTCCTTGGGGTGG - Intronic
1101918842 12:108916465-108916487 CTCATTCTTTGTCATGGGGGTGG + Intronic
1102527655 12:113523416-113523438 ATGGTTCCTTATTTTGGGGGTGG + Intergenic
1103851328 12:123935360-123935382 GGCGTTCCTTCTCATGGAGGTGG - Exonic
1106606079 13:31230627-31230649 ATCGTACTTTCTCAAGGGAGAGG + Intronic
1108721647 13:53138696-53138718 ACCGTTCCTTCTCAAGAGGGAGG - Intergenic
1109275037 13:60294464-60294486 ATTCTTCCTTCTCATGAGCGTGG - Intergenic
1109860716 13:68194439-68194461 ATACTTCTTTCTCATGGAGGTGG - Intergenic
1113581901 13:111435850-111435872 ATGGTTTCTGCTCAAGGGGGTGG + Intergenic
1113915902 13:113874154-113874176 GTCGTTTCTTCTCAAGGGTGTGG + Intergenic
1132222927 15:100118411-100118433 ATCTCTTCTTCTCCTGGGGGAGG - Intronic
1132302094 15:100782152-100782174 AGCATTCCATATCATGGGGGGGG + Intergenic
1132412768 15:101597135-101597157 CTGGTTCCTTCTCATTTGGGTGG + Intergenic
1133641947 16:7725588-7725610 CTGGTTCCTTCTCATCGGGGTGG + Intergenic
1138394384 16:56692691-56692713 ACCGTTGCTTCTCATGGAGGAGG + Intronic
1139214921 16:65118291-65118313 GTCCTTCCTGCTCATAGGGGAGG + Intronic
1147949541 17:44099330-44099352 AACCTTCCTTCTCCTGGGAGTGG + Intronic
1150256732 17:63752257-63752279 TTTGTTTCTTCTCAAGGGGGAGG - Intronic
1151085429 17:71374891-71374913 ATCGTTCTTTCTACTTGGGGAGG + Intergenic
1151237010 17:72727968-72727990 ATAGTTCCTTTTCTTGTGGGTGG + Intronic
1153396290 18:4625300-4625322 CTGGTTCCTTCTCATTTGGGTGG + Intergenic
1156932030 18:42656974-42656996 ACCTTTCCTTCTCATGAAGGTGG + Intergenic
1162653483 19:12109758-12109780 ATCGTTTCTTCTCATGAGTTTGG + Intronic
1163361943 19:16852274-16852296 ATCATTCTTTCTCCTGTGGGGGG + Intronic
1163722622 19:18905448-18905470 GTCTTTCCTTTCCATGGGGGTGG - Intronic
927852033 2:26505384-26505406 TTCCTCCCTTCTGATGGGGGAGG + Intronic
929908853 2:46071570-46071592 ATCCTTCATTCTCATTGGTGTGG - Intronic
934333603 2:92100072-92100094 AACGTTCCTTTTCATAGAGGAGG + Intergenic
935100037 2:99985579-99985601 ATTGTTCTTTCTCATGGTAGTGG - Intronic
935597206 2:104888606-104888628 TTCCTTCCTTCTCGTGGGGGTGG - Intergenic
935945264 2:108280462-108280484 TAAGTTCCTTCTCATGGGGATGG - Intergenic
937056315 2:118940414-118940436 ATCTTTGATTCTCATGGGTGTGG - Intergenic
940423632 2:153507773-153507795 CTAGTTCCTTCTCATTTGGGTGG + Intergenic
947201043 2:227614905-227614927 ATGCCTCCTTCTCCTGGGGGAGG + Intronic
1170916209 20:20628572-20628594 ATAGTTCTTTGTCATGGTGGGGG + Intronic
1172184423 20:33022444-33022466 ATCGTTCCTTCTCATGGGGGCGG - Intronic
1175256410 20:57650363-57650385 GTCTTTCCTCCCCATGGGGGTGG - Exonic
1175805479 20:61826163-61826185 GTCATCCCTTCTCGTGGGGGTGG + Intronic
1177648800 21:23934697-23934719 AACGTTCCTTCTTATCGGGCAGG + Intergenic
1179644254 21:42765966-42765988 AGTGCACCTTCTCATGGGGGAGG - Intronic
1181695457 22:24590715-24590737 ATGGATCCTTCCCTTGGGGGCGG + Intronic
1181907743 22:26212747-26212769 ATCCTTCTTTCTCAAGGGGCAGG - Intronic
1202727911 2_KI270716v1_random:24974-24996 AACGTTCCTTTTCATAGAGGAGG + Intergenic
1202728133 2_KI270716v1_random:28386-28408 AACGTTCCTTTTCATAGAGGAGG + Intergenic
950895015 3:16440673-16440695 ATGGTTACTGCTAATGGGGGGGG + Intronic
954870102 3:53761339-53761361 CTGGCTCCTTGTCATGGGGGTGG - Intronic
956704761 3:71989751-71989773 ATAGCTCCTTCTTATGTGGGAGG + Intergenic
961202155 3:125053890-125053912 CTCTTTCCTTCTCTTAGGGGCGG - Intronic
965052633 3:163670783-163670805 CTTGTTCCTTCTCATTTGGGTGG + Intergenic
966514140 3:180798514-180798536 CTAGTTCCTTCTCATTTGGGCGG - Intronic
967084030 3:186078067-186078089 CTCCTTCCTTCTCAGGGGGCTGG + Intronic
969628410 4:8320576-8320598 GCCGTCCCTCCTCATGGGGGTGG + Intergenic
976686254 4:87818915-87818937 CTGGTTCCTTCTCATTTGGGTGG + Intergenic
976963015 4:91002854-91002876 CTGGTTCCTTCTCATTTGGGTGG + Intronic
977769425 4:100839743-100839765 TTTGTTCCTTCTCAGGTGGGAGG + Intronic
980616519 4:135233418-135233440 GTCCTTCATTCTCATGAGGGCGG - Intergenic
981088735 4:140710716-140710738 ATTTTTCCTTCTCCTGGGTGGGG + Intronic
981459420 4:144995970-144995992 CTGGTTCCTTTTCATGGAGGAGG - Intronic
984624910 4:181996187-181996209 AGCTTACCTTCTCCTGGGGGAGG + Intergenic
988344705 5:30021658-30021680 CTGGTTCCTTCTCATTTGGGTGG - Intergenic
995374999 5:111463879-111463901 CTGGTTCCTTCTCATTTGGGTGG - Intronic
997668385 5:135650405-135650427 ATGCTTCCTTCACATGGGGTGGG + Intergenic
999108739 5:149096186-149096208 CTGGTTCCTTCTCATTTGGGTGG - Intergenic
999677187 5:154015658-154015680 CTGGTTCCTTCTCATTTGGGTGG - Intronic
1001314518 5:170632923-170632945 AGCGTTCCCTCGCGTGGGGGTGG + Intronic
1002097768 5:176841689-176841711 ATCTTTACTTCTCTTGGGAGTGG - Intronic
1007125133 6:39419467-39419489 ATCGTGCCTTCCCAAGGTGGAGG - Intronic
1009453271 6:63825779-63825801 CTGGTTCCTTCTCATTTGGGTGG - Intronic
1010076269 6:71802816-71802838 CTGGTTCCTTCTCATTTGGGTGG + Intergenic
1011507877 6:88067969-88067991 CCCGTTCCTTCTCACGGGGCGGG - Intergenic
1020788077 7:12593553-12593575 ATAGTTCCTTCTCAGGAGGCAGG + Intronic
1021269339 7:18566105-18566127 ATAGTTGCTTCTTAAGGGGGTGG - Intronic
1022466032 7:30653697-30653719 ACAGTTCCTTGTCATGAGGGTGG - Intronic
1022934307 7:35156322-35156344 ATCCTTCCTACCCATGGGCGTGG - Intergenic
1026332843 7:69367910-69367932 ATCACTCCTTCTCTTGGGAGCGG - Intergenic
1028320418 7:89452570-89452592 ATTTTTCCCTCTCCTGGGGGTGG - Intergenic
1028394572 7:90353352-90353374 ATCTTGCCTTCTAATGGTGGTGG - Intronic
1031879319 7:127177884-127177906 CTGGTTCCTTCTCATTTGGGTGG - Intronic
1033433846 7:141314380-141314402 AAGGTTCCTTCTGATGGGGCAGG + Intronic
1046885447 8:119361883-119361905 ATATTTCATTCTAATGGGGGAGG - Intergenic
1052625182 9:30965739-30965761 ATCATTTCTACTCATGGAGGTGG - Intergenic
1056529028 9:87470668-87470690 ATAGTTCCTTTTCTTGGTGGAGG + Intergenic
1056950853 9:91039781-91039803 CTTGTCCCTTCTCTTGGGGGCGG - Intergenic
1059986874 9:119828900-119828922 ATAGTTATTTTTCATGGGGGGGG + Intergenic
1191008422 X:55736577-55736599 CTGGTTCCTTCTCATCTGGGTGG + Intronic
1192067737 X:67904087-67904109 CCCGTTCCTCCTCATGGGGTGGG - Intergenic
1193078056 X:77375897-77375919 CTGGTTCCTTCTCATTTGGGTGG - Intergenic
1193154688 X:78159444-78159466 CTGGTTCCTTCCCATTGGGGTGG - Intergenic
1193156957 X:78183887-78183909 CTGGTTCCTTCTCATTTGGGTGG - Intergenic
1194298948 X:92162125-92162147 CTGGTTCCTTCTCATTTGGGTGG + Intronic
1197463499 X:126772215-126772237 CTGGTTCCTTCTCATTTGGGTGG - Intergenic
1200009237 X:153108857-153108879 ATCGTCCCTGCCCCTGGGGGAGG + Intergenic
1200030363 X:153291065-153291087 ATCGTCCCTGCCCCTGGGGGAGG - Intergenic
1200616553 Y:5386962-5386984 CTGGTTCCTTCTCATTTGGGTGG + Intronic