ID: 1172184646

View in Genome Browser
Species Human (GRCh38)
Location 20:33023743-33023765
Sequence GGAGACTGCATGTAGGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172184646_1172184655 16 Left 1172184646 20:33023743-33023765 CCAGTTCCCTACATGCAGTCTCC 0: 1
1: 0
2: 1
3: 13
4: 152
Right 1172184655 20:33023782-33023804 TGGAGCCACCAACGCTGCCTGGG 0: 1
1: 0
2: 2
3: 17
4: 123
1172184646_1172184654 15 Left 1172184646 20:33023743-33023765 CCAGTTCCCTACATGCAGTCTCC 0: 1
1: 0
2: 1
3: 13
4: 152
Right 1172184654 20:33023781-33023803 CTGGAGCCACCAACGCTGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 181
1172184646_1172184650 -4 Left 1172184646 20:33023743-33023765 CCAGTTCCCTACATGCAGTCTCC 0: 1
1: 0
2: 1
3: 13
4: 152
Right 1172184650 20:33023762-33023784 CTCCAGGTTCTGTCTGTCCCTGG 0: 1
1: 0
2: 2
3: 33
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172184646 Original CRISPR GGAGACTGCATGTAGGGAAC TGG (reversed) Intergenic
901161108 1:7177262-7177284 GGAGCCTGCGTGTTGGGAAGGGG - Intronic
904062061 1:27719416-27719438 GGAGACATCATGTAGGCAGCAGG - Intergenic
905882628 1:41474665-41474687 GGGGACTGCAGGCTGGGAACTGG - Intergenic
906821471 1:48934696-48934718 GGAGACTGGTTGTAGGGATGAGG - Intronic
907848274 1:58229420-58229442 GGAGACTGCATCTTGGAACCAGG + Intronic
909959890 1:81827076-81827098 GGAGTCCGCATATAGGGAATTGG + Intronic
912437146 1:109669600-109669622 GGAGACTGGGAGTAGGGAAGGGG - Intronic
912555868 1:110515646-110515668 AGAGATTTCTTGTAGGGAACCGG - Intergenic
915032660 1:152896849-152896871 GAAGTCTGCATGTAGGGATGAGG - Intergenic
915095182 1:153457525-153457547 GGTGGCTGCATTTAGGGAGCGGG + Intergenic
917803071 1:178587676-178587698 GAAGACTGGAGGTAGGAAACTGG + Intergenic
918248478 1:182681165-182681187 GGAGGCTGCATGGATGGGACAGG + Intronic
919051589 1:192517959-192517981 GGAGGCTGCATGAAGGAAAAAGG + Intergenic
921151790 1:212408656-212408678 GAAGACTGCATGGAAGGGACCGG - Intronic
921991717 1:221373742-221373764 GGAGACTGGAGGTAGGAAAGAGG + Intergenic
922191966 1:223327335-223327357 GGAGACTGGGAGTAGGGAATAGG + Intronic
1063187199 10:3662498-3662520 GGCGAATGGATGTAGGGATCTGG + Intergenic
1063221446 10:3972245-3972267 GGAGACTTCATGTAGAAAATGGG + Intergenic
1069282955 10:66678316-66678338 AAAGACTGCAGGTAGGGAATAGG - Intronic
1070337501 10:75468384-75468406 GGTCATTGCATGTAGGGGACAGG + Intronic
1070546450 10:77456606-77456628 GGAGGCTGCATGGAGGAGACTGG + Intronic
1071089804 10:81905028-81905050 GGAGACTGCATGAAAGGGTCAGG - Intronic
1073163799 10:101425521-101425543 TGAGACTGCATGTAAGGAGTAGG + Intronic
1073831274 10:107386129-107386151 GGGGACTGCATGTACAGAAAAGG - Intergenic
1074093498 10:110286228-110286250 AGAGACTGCCTGTAGGAAAATGG - Exonic
1078639664 11:13082934-13082956 GGAGACTCCATGCATGGAGCTGG + Intergenic
1080005344 11:27400376-27400398 GGAGAAGGCACGTAGGAAACAGG - Intronic
1082258592 11:50059973-50059995 GGAGACTGCAGGTTGGGGAAGGG - Intergenic
1083539833 11:63505017-63505039 GGAGAGTGCATGAAGGGTCCTGG - Intergenic
1086500609 11:87449277-87449299 GGAGATTGCATGAAGGGGAGAGG + Intergenic
1086861104 11:91925911-91925933 AGAGGCTACATGTAGGGAACTGG - Intergenic
1088751051 11:112842407-112842429 GGAGGCTGCATGCAGTGAAGGGG - Intergenic
1089700543 11:120241440-120241462 GGAAACAGCATCTGGGGAACTGG - Intronic
1090705583 11:129333405-129333427 GGAAACTGCTGGAAGGGAACAGG + Intergenic
1091903965 12:4167930-4167952 GGAGACTGTAAGTAGAGCACAGG - Intergenic
1096086523 12:48868754-48868776 TGAGACTGAAGGTAGGGGACAGG - Intergenic
1097039495 12:56146951-56146973 GGATTCTGTATGTAGGGAAGAGG - Intergenic
1097144786 12:56932608-56932630 CAAGGCTGAATGTAGGGAACTGG + Intronic
1100184968 12:92129066-92129088 GAAGACTGCATGGAGGGAGGGGG + Intronic
1102254356 12:111407083-111407105 GGGGACTGCATTTGAGGAACTGG + Intronic
1102977934 12:117220026-117220048 GGAGAGTGGATGTAGGAAAAGGG + Intronic
1104544442 12:129698612-129698634 GGAGACGGCATGGAGGGGAGGGG + Intronic
1106897589 13:34321383-34321405 GGAGACTGCACTGATGGAACAGG + Intergenic
1109185143 13:59259375-59259397 GGAGACTGCCTGTACTCAACAGG - Intergenic
1111728455 13:92042160-92042182 GGAGGCTGCATGGGGGGAAGTGG - Intronic
1114757826 14:25280335-25280357 GGAGACTGCAGGTAAGGAAGAGG - Intergenic
1116192261 14:41676037-41676059 CCAGACTGGATGTAGGGAAAAGG - Intronic
1116916601 14:50532122-50532144 GGAGGCTCCATGTTGGGAAGCGG - Exonic
1118561868 14:67093906-67093928 TGAGACTGCAAGAAGGGCACAGG - Intronic
1119078710 14:71671707-71671729 AGAAACTGCATGTAAGGAAGAGG - Intronic
1122696077 14:103552904-103552926 GGAGACAGAAGGTGGGGAACTGG + Intergenic
1122985985 14:105211809-105211831 GGAGCCTGTATGTAGGAAGCAGG - Intronic
1129412540 15:75358131-75358153 GGAGACTGCTTGTGTGGAACAGG - Intronic
1132889782 16:2197760-2197782 GGAGACCCCACGGAGGGAACGGG - Intergenic
1133555467 16:6902708-6902730 CAAGACTCCATGTAGAGAACAGG + Intronic
1139428129 16:66895739-66895761 GGGGACTGGCTGTAGGGAATGGG - Intronic
1141535823 16:84679014-84679036 TGAGATTGCATGCAGGGAATTGG - Intergenic
1141855282 16:86677009-86677031 GGCCACTGCTTGGAGGGAACTGG + Intergenic
1144296392 17:13879047-13879069 GGAGACTGCATAGAAAGAACAGG + Intergenic
1145024172 17:19455317-19455339 GGGGAATGCATGTAGGAAAAGGG - Intergenic
1148255874 17:46131758-46131780 TGAGACTGCAAGCTGGGAACTGG - Intronic
1150426702 17:65082759-65082781 GGAGGCTGGGTGTAGGGAATTGG + Intergenic
1151809394 17:76428866-76428888 GGAAACTGCATGAAGGGTAGAGG + Intronic
1157157474 18:45281954-45281976 GGAGGCTGCAAGTAGGAACCAGG - Intronic
1157325826 18:46668356-46668378 GGAGCCTGCATGAAGGCAGCCGG - Intronic
1161270047 19:3384827-3384849 GGTGACTGCCTGTTGGGAGCAGG + Intronic
1167650213 19:50724743-50724765 GGAGGCTGAATGCAGGGAGCGGG + Intronic
925077528 2:1030008-1030030 GGAGGCAGCATGCAGGGAAAGGG - Intronic
927226391 2:20769127-20769149 GGAGACAGCATGAAGAGAAATGG - Intronic
931949614 2:67348027-67348049 GCAGACTGCATGTAGGAAGATGG - Intergenic
935849698 2:107205063-107205085 GGAGCCACCATGTAGGTAACAGG + Intergenic
936099591 2:109563714-109563736 GGAGAGTGCTTGTAGGGAGTTGG - Intronic
938079573 2:128362598-128362620 GAGGACTGCACGCAGGGAACAGG - Intergenic
938126795 2:128680076-128680098 GGAAACTGAATGAAGGGTACAGG + Intergenic
940136287 2:150439783-150439805 GGAGACAGATTGGAGGGAACAGG - Intergenic
940958358 2:159754530-159754552 GGAGACTGGAGATAGGGAACAGG + Intronic
946071280 2:217036205-217036227 GAAGAATGCTTGTCGGGAACCGG + Intergenic
1168858249 20:1025537-1025559 GGTGGCTGCATGGGGGGAACAGG - Intergenic
1171039338 20:21745327-21745349 GGAGACTGCAGGAATGGAAGTGG + Intergenic
1172184646 20:33023743-33023765 GGAGACTGCATGTAGGGAACTGG - Intergenic
1173532568 20:43781729-43781751 GGAGACAGGATGCAGGGACCTGG - Intergenic
1174447998 20:50603082-50603104 GGAGACAGCAGGAAGGGAAGGGG - Intronic
1175039926 20:56039117-56039139 GGTGACTGCATTTAGGGGACCGG - Intergenic
1176114611 20:63426107-63426129 GGAGTCTGCAGGCAGGAAACAGG - Intronic
1176915176 21:14617135-14617157 GGACATTGCTTGTAGGGAAGAGG + Intronic
1179954084 21:44728167-44728189 GGAGCCTGCATGGAGGGGACAGG + Intergenic
1181152452 22:20894640-20894662 GGCATCTGCAAGTAGGGAACTGG + Intergenic
1181922445 22:26331098-26331120 GGAGCCTGGATGTGGGGAGCAGG - Intronic
1183082279 22:35464156-35464178 AGACACTGCAGGTAGGGAAGGGG - Intergenic
1184075747 22:42176451-42176473 GCTGACTGCATGATGGGAACAGG - Intronic
1184583895 22:45434878-45434900 GGACACTCCCTGTAGGGAAAGGG + Intergenic
1185238499 22:49728081-49728103 GGGGACTGCATGTTTGGAATAGG + Intergenic
950358574 3:12433599-12433621 GGAAACTTCATTTGGGGAACAGG + Intronic
951878634 3:27458410-27458432 GGAGACTGACTGTACGTAACAGG + Intronic
953902708 3:46852212-46852234 GGTGACGGAATGTATGGAACAGG - Intergenic
955650924 3:61193052-61193074 GGAGACTGGATTTAGGGGATTGG - Intronic
961135369 3:124505037-124505059 GGAGCCTGCAGGTAGAGAAGTGG + Intronic
965800261 3:172485181-172485203 GGAGACTGCGTCTAGGAAACAGG + Intergenic
966862394 3:184237592-184237614 GAAGACTCCATGAAGGGGACAGG - Intronic
968601048 4:1509475-1509497 GGAGACAGCAGGCAGGGCACAGG + Intergenic
968805869 4:2772073-2772095 GGAGAATGCAGGGAGGGAGCAGG + Intergenic
969337352 4:6519468-6519490 GGAGGCTGCATGACGGGAGCTGG - Intronic
970497456 4:16641220-16641242 GGAGACGGCAGGTAGGAAACTGG + Intronic
970670242 4:18388419-18388441 GGAGACACCATGCAGGGCACAGG - Intergenic
972225062 4:37002894-37002916 CTAGACTGCATATAGGGAAGAGG - Intergenic
976491269 4:85673306-85673328 GGAAACTGCATGTAGGTGAGTGG - Intronic
977438418 4:97031235-97031257 GGAGAATGCATGGAGTGAAAAGG - Intergenic
977621778 4:99146447-99146469 GGAGGCTACAGGTAGGAAACAGG - Intronic
980070422 4:128237438-128237460 GGAAACTGCATGTGGGGTATGGG + Intergenic
982680400 4:158421304-158421326 GGAGACTGGAGGTAGGGGAAGGG + Intronic
984345883 4:178524474-178524496 GGAGACTGGAAGATGGGAACAGG + Intergenic
984992840 4:185397201-185397223 GGCGACTGCTTGCAGGGATCCGG - Exonic
985169073 4:187128937-187128959 GGAGCATGCACGCAGGGAACTGG - Intergenic
985651811 5:1111186-1111208 GGAGCCAGGATGGAGGGAACAGG + Intronic
985745596 5:1645121-1645143 GGGGACTGCAGGAAGGGAACAGG - Intergenic
985824442 5:2181980-2182002 GGGGACACCATGGAGGGAACTGG + Intergenic
987792883 5:22591122-22591144 AGAGACTGCATTTAGGTAAGGGG - Intronic
988808380 5:34761586-34761608 GGAGACAGGATGTAGGTAAGTGG - Intronic
988838712 5:35061705-35061727 GGAAACTGAATCTAGGCAACGGG - Exonic
989781132 5:45265904-45265926 GGAGAATGCATCCAAGGAACTGG + Intronic
990557988 5:56953677-56953699 GGAGACTGGAGGTAGGGAGAGGG + Intronic
990852652 5:60224569-60224591 TGAGACTGCCTGTAGGGGAGAGG - Intronic
993140862 5:84031542-84031564 GGAGTCTTCATGAATGGAACTGG + Intronic
993890819 5:93469740-93469762 GGAGTGTGGATGTAGGGAATAGG - Intergenic
993975653 5:94476467-94476489 GAAGGCTGCATGGTGGGAACAGG + Intronic
994731510 5:103497268-103497290 GAACACTTCATGTAAGGAACAGG - Intergenic
1000651905 5:163829162-163829184 GGAAACTGCATGTAAGTGACAGG - Intergenic
1004463173 6:15858021-15858043 GGAGTCTGCATGTGGGGGAAGGG - Intergenic
1006876582 6:37302735-37302757 GGAAATGCCATGTAGGGAACCGG - Intronic
1007251498 6:40498168-40498190 GGAGACTGAGTGGAGGGAAATGG + Intronic
1007436450 6:41815942-41815964 GTAGAGTTCATCTAGGGAACTGG + Intronic
1012085309 6:94818284-94818306 AGACACTGCATGTAGGGGATGGG - Intergenic
1015128309 6:129780034-129780056 TGAGATAGCATGTAAGGAACTGG - Intergenic
1015456358 6:133431112-133431134 GGAGATGGGATGTAGGGAATTGG + Intronic
1015566172 6:134573846-134573868 GGTGACTGCTTGCAGGGGACGGG + Intergenic
1015952632 6:138569052-138569074 GGAGACAGCGGGCAGGGAACAGG + Intronic
1021913547 7:25409612-25409634 AGAAAATGCATGAAGGGAACCGG - Intergenic
1022259816 7:28693298-28693320 GGAGACTGCATTGTGTGAACTGG + Intronic
1023071606 7:36440269-36440291 GGAGACTGCAGGGAGAGAAACGG + Intronic
1026463104 7:70631901-70631923 GGAGACTGCCTGTGGTGAAAAGG + Intronic
1028335469 7:89648288-89648310 TGAGACATCATGTAGGGAAAGGG + Intergenic
1031026523 7:116685771-116685793 AGAGTCTGCATGTCGGTAACTGG + Intronic
1031962881 7:128005725-128005747 GGAGACTGCAGGTACTGAACAGG + Intronic
1033492332 7:141855561-141855583 GAAGACTGCATGCAGGGAGTGGG + Intergenic
1038512644 8:28153866-28153888 GATGACTGTATGTAGGAAACTGG - Intronic
1038871121 8:31495013-31495035 GGAGAGTGTATGTGGGGAAGGGG + Intergenic
1047956705 8:129982025-129982047 GGATACTGTGTGTAGTGAACAGG + Intronic
1048539358 8:135328331-135328353 GGAGACTGAGTGGAGGCAACGGG + Intergenic
1048921592 8:139236253-139236275 GGAGAGTGCATGCAGGGAACGGG + Intergenic
1053091223 9:35278992-35279014 TATGACTACATGTAGGGAACAGG + Intronic
1056189538 9:84171304-84171326 GGAGACTTCATCTGGGGAGCCGG - Intergenic
1056921042 9:90789502-90789524 GGAAACTGCATCAAGAGAACTGG + Intergenic
1058758271 9:108104189-108104211 GGGGACTGCATTTGGGGCACAGG + Intergenic
1059164211 9:112063290-112063312 GGAGGGGGCATGTAGGGAATGGG + Intronic
1060284368 9:122235916-122235938 GGAGACTGGATATAGGGAGTGGG + Intergenic
1061601753 9:131674967-131674989 GGAGTCTGCTTCTGGGGAACCGG - Intronic
1186693655 X:12006104-12006126 GGATATTGGATGTAGGGACCAGG - Intergenic
1189183024 X:39020963-39020985 GGTAACTGCATGAAGGGTACAGG - Intergenic
1189706078 X:43760180-43760202 GGAGAGGGCATGCAGGGAATTGG + Intergenic
1190756783 X:53408364-53408386 GGAGGCTGCAGGAAGGGAACTGG - Intronic
1191136450 X:57070028-57070050 GGAGACTGCATGTACAGAAATGG - Intergenic
1191919458 X:66239148-66239170 GGATACTGGATGTTGGGAACAGG - Intronic
1192587964 X:72335100-72335122 GGAAACTGCCTGTAGGGGAAGGG - Intronic
1194725767 X:97394933-97394955 GGATACACCATGTAGGGAGCAGG - Intronic
1195671652 X:107474956-107474978 GGAGACTACAAGTGGAGAACGGG + Intergenic
1196964939 X:121045228-121045250 AAAGACTACATGTTGGGAACAGG + Intergenic
1198590192 X:138171325-138171347 GGAGACTGCAAGGTGGGAAATGG + Intergenic