ID: 1172188024

View in Genome Browser
Species Human (GRCh38)
Location 20:33043570-33043592
Sequence AGTAATTGGCCCAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172188024_1172188028 6 Left 1172188024 20:33043570-33043592 CCTGCCATCTTGGGCCAATTACT 0: 1
1: 0
2: 2
3: 5
4: 157
Right 1172188028 20:33043599-33043621 CTGTCTGTGTCTCCATTTTCCGG 0: 1
1: 0
2: 4
3: 86
4: 443
1172188024_1172188030 18 Left 1172188024 20:33043570-33043592 CCTGCCATCTTGGGCCAATTACT 0: 1
1: 0
2: 2
3: 5
4: 157
Right 1172188030 20:33043611-33043633 CCATTTTCCGGTGCATAAAATGG 0: 1
1: 0
2: 1
3: 11
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172188024 Original CRISPR AGTAATTGGCCCAAGATGGC AGG (reversed) Intronic
901736567 1:11316342-11316364 AGTAAATGGTCCAGGCTGGCTGG + Intergenic
903137226 1:21317547-21317569 AGTCATGGGCCCAGGCTGGCTGG + Intronic
905269896 1:36781017-36781039 AGCAGTTGGCCCCTGATGGCAGG + Intergenic
905485303 1:38292021-38292043 AGCAGTTGGCCCCAGATTGCTGG + Intergenic
907721046 1:56972478-56972500 AGTAATTGGCTCATGGAGGCAGG + Intergenic
908179506 1:61589804-61589826 AATGATTGGCCCTAGATGGATGG - Intergenic
908597480 1:65703957-65703979 AGTGATAGTCCCAGGATGGCTGG + Intergenic
909248256 1:73318100-73318122 AGCACTTAGCCCAAGATGACTGG - Intergenic
910254738 1:85236686-85236708 AGCAATTGGCCCAAGGTCACAGG + Intergenic
910287556 1:85572464-85572486 AGTAATTGGTGCAAGGGGGCAGG - Intronic
911274295 1:95841674-95841696 AGTGATTGCCCAAAGATGGTTGG - Intergenic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
914197052 1:145452974-145452996 AGTGACTGCCCCAAGATGCCTGG - Intergenic
915528914 1:156492264-156492286 AGTAAATGGCCCAGGACAGCAGG + Intronic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
917011445 1:170478543-170478565 AGAAATTGGGGCAAGATGTCTGG + Intergenic
919849253 1:201661453-201661475 AGAAATAGGGCCAAAATGGCTGG + Intronic
919891703 1:201980172-201980194 AGAAATTGGACCAAGGTGCCAGG - Intergenic
921044963 1:211469564-211469586 AGTAAGTGTCCCAAAATGGTGGG + Intergenic
1065904895 10:30241680-30241702 AGGAATTGGTCAAAGATGACAGG + Intergenic
1066712615 10:38252023-38252045 AACAATTGGCCCCAAATGGCCGG - Intergenic
1067175694 10:43943991-43944013 AGTAAATGGCCCTGGCTGGCAGG + Intergenic
1067442430 10:46316557-46316579 AGTGATGGGCTCAACATGGCAGG + Intronic
1067936275 10:50614845-50614867 AGTAATTTGCCCAAGAAAGTAGG - Intronic
1068321718 10:55426817-55426839 AGAAATTGGCCAGAGGTGGCCGG - Intronic
1077718772 11:4606752-4606774 AGAAATTTGCCCAAGATAGATGG - Intronic
1078709628 11:13778495-13778517 AGTAATTTGCTCAAGGTAGCAGG - Intergenic
1079714576 11:23730033-23730055 AGTAATTGACTCAGAATGGCCGG - Intergenic
1080167070 11:29251541-29251563 AGAAATTGAACCAAGATGACTGG + Intergenic
1080842305 11:35996091-35996113 AGTGTTTGGCCCAAGAGGCCTGG + Intronic
1081833456 11:46134457-46134479 AGTAAATGGACCATGATGACTGG - Intergenic
1083771542 11:64870377-64870399 AGTAATTGGCCTAAGATGACAGG - Intronic
1083948439 11:65939863-65939885 AAAAAATGGCCCAAGCTGGCCGG + Intergenic
1084110542 11:67011568-67011590 AATCATTGTCCCCAGATGGCAGG + Intronic
1086615993 11:88820572-88820594 AGCTATTTGCCCAAGATTGCAGG - Intronic
1087153256 11:94877520-94877542 AGTAATGTGCAAAAGATGGCAGG + Intergenic
1088778485 11:113110092-113110114 TATATTTGGCCAAAGATGGCAGG + Intronic
1089942890 11:122438034-122438056 AGTAATTTGCCCAAGGATGCAGG + Intergenic
1093497285 12:19772798-19772820 AGTCATTTGCCCAAGGTTGCAGG + Intergenic
1095934488 12:47662127-47662149 AGTGATTGGGTCAAGAGGGCAGG - Exonic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099593692 12:84629092-84629114 AGCAATCAGGCCAAGATGGCAGG + Intergenic
1101579514 12:106030393-106030415 AGTAAACGGCCCAAGATCACAGG + Intergenic
1102112570 12:110375619-110375641 AGTAACTTGCCCAAGATCACAGG + Intronic
1105713248 13:23033692-23033714 AGTAATCGGCCCAGAATGGAAGG + Intergenic
1106444511 13:29814585-29814607 TGTAATAGGCCCAAGATGTAAGG + Intronic
1106599273 13:31173956-31173978 AGTGAGTGGCCCAAGTTGGGGGG - Intergenic
1107724087 13:43280144-43280166 AGTAAATGGGCCAACCTGGCTGG - Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1114059043 14:19002194-19002216 TGTAATCGGCCCAGGATGGAGGG - Intergenic
1114103500 14:19399560-19399582 TGTAATCGGCCCAGGATGGAGGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1118808061 14:69254915-69254937 ACTACATGGCCCAAGATGCCAGG - Intergenic
1118930610 14:70236767-70236789 AGTAATTGACCCTGGATAGCAGG - Intergenic
1118954255 14:70465487-70465509 AGTAATTGACCCTGGATAGCAGG + Intergenic
1202836308 14_GL000009v2_random:79734-79756 AGTAATCAGCCCAGGATGGAGGG - Intergenic
1123431761 15:20223920-20223942 AGTAATTAGCTCATGATGGTTGG - Intergenic
1125448815 15:39786553-39786575 AGTAATTGTCCCAAGGTCGTTGG + Intergenic
1130337170 15:82966255-82966277 AGTAACAGGCCCAAGATGAAGGG + Intronic
1131640971 15:94293534-94293556 AGGACTTGGCCCCAGAGGGCCGG + Intronic
1134004573 16:10809671-10809693 AGTTCTGGGCCCAAGCTGGCAGG - Intronic
1136852888 16:33627319-33627341 AGTAATTAGCTCATGATGGTTGG + Intergenic
1140363868 16:74367058-74367080 AGAAATTAGCACAAGTTGGCCGG + Intergenic
1141708408 16:85682884-85682906 AGGAATTGGGCCAGGATTGCAGG - Intronic
1203114484 16_KI270728v1_random:1475739-1475761 AGTAATTAGCTCATGATGGTTGG + Intergenic
1143540381 17:7564955-7564977 AGGAATTCGTCCAAGATGCCTGG - Exonic
1143856600 17:9855745-9855767 AGTAACTTGCCCAAGATCACCGG + Intronic
1148133760 17:45278565-45278587 AGTAATTTGCCCAAGGTCACTGG + Intronic
1153925719 18:9833166-9833188 AGAAAATGGCCCAGGAAGGCCGG + Intronic
1166726997 19:45034489-45034511 AGGAAGTGGTCCAGGATGGCCGG - Exonic
929769886 2:44883004-44883026 AGTAATTTGCCCAAGGTTACGGG + Intergenic
932794150 2:74680487-74680509 ACTAATGGGCCCAAGATAGGGGG - Exonic
933602636 2:84348401-84348423 GGTAGTGGGGCCAAGATGGCTGG - Intergenic
933674415 2:85041228-85041250 AGTAATTCTGCTAAGATGGCAGG - Intronic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
936442053 2:112563023-112563045 AGAAATTGTCACAAGCTGGCCGG - Intronic
937171862 2:119880205-119880227 ACTAATTTGCCCAAGATCACAGG + Intronic
938477515 2:131629453-131629475 TGTAATCGGCCCAGGATGGAGGG - Intergenic
938820151 2:134949462-134949484 GATAATTGGCCAAATATGGCTGG - Intronic
939498149 2:142948662-142948684 AGTAATTGAATCAAGAGGGCAGG - Intronic
939646271 2:144702914-144702936 AGTCACTGGCTCAAGATGACAGG + Intergenic
940707486 2:157123993-157124015 AGTAATTTGCCCAAGATTCATGG + Intergenic
946105823 2:217368490-217368512 GGTACTTGGCCCAAGTTGCCTGG + Intronic
946533627 2:220603088-220603110 AGTATTTAGCCAAAGATGGAAGG + Intergenic
946750046 2:222885169-222885191 ATTAAATGGCCCAAGGTGACAGG - Intronic
1170973053 20:21134378-21134400 AGTAATTGCCCCAAGGTCACCGG - Intronic
1172188024 20:33043570-33043592 AGTAATTGGCCCAAGATGGCAGG - Intronic
1172759920 20:37314689-37314711 AGTGATTGTCCCAAGATAACTGG - Intronic
1173759408 20:45546620-45546642 AGTAACTTGCCCAAGATTACAGG + Intronic
1174615773 20:51834285-51834307 AATAATTTGCCCAAGGTGGCCGG - Intergenic
1178081438 21:29070455-29070477 GGTATTTGGCACAAGAGGGCTGG + Intronic
1180477527 22:15724810-15724832 TGTAATCGGCCCAGGATGGAGGG - Intergenic
1183297009 22:37035996-37036018 AGTGACTTGCCCAAGATGACAGG + Intergenic
1183300832 22:37058336-37058358 TGTAACTTGCCCAAGGTGGCAGG - Intronic
953583493 3:44178349-44178371 AGTCATTGGCCCTGGAGGGCTGG + Intergenic
955898311 3:63724740-63724762 AGTGATTGGCCCAAGGTCACAGG + Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956859440 3:73307916-73307938 GGTAACTTGCCCAAGGTGGCAGG + Intergenic
958736861 3:98019545-98019567 AGTAATTGATCCAATATGTCAGG - Intronic
959549645 3:107640153-107640175 AGGAATTGGCCCACAATTGCAGG + Intronic
960848193 3:122023719-122023741 AGTAAGTGGCCAAAGATAGATGG + Intergenic
960873892 3:122277341-122277363 AAAAAGTGGTCCAAGATGGCTGG - Intronic
963545786 3:146657439-146657461 TGTACTTGGTTCAAGATGGCTGG + Intergenic
969847882 4:9933872-9933894 AGGAGTTGGCCCAAGGTTGCTGG - Intronic
970759317 4:19465154-19465176 AGCAATTGGCCCAGAATGTCAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977595308 4:98873044-98873066 AGTGATTGGCACAAAATGACAGG + Intronic
977825383 4:101525074-101525096 AGTAATTGGCTGAAGTGGGCTGG - Intronic
978489263 4:109294239-109294261 AGGAAATGGCACCAGATGGCAGG - Intronic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
983276935 4:165629022-165629044 ATTAATTTGCCCAAAATGGCAGG - Intergenic
984474094 4:180215375-180215397 AGAAAATGGCCCAGGAAGGCTGG - Intergenic
984852482 4:184166423-184166445 AATAATTGCACCAAGCTGGCAGG - Intronic
985431747 4:189887934-189887956 AGAAATTGGCCCAAAATGAAGGG + Intergenic
986661317 5:10062735-10062757 AATAATTGGCCCCAAATGGCTGG + Intergenic
986763837 5:10904863-10904885 AGCAAATGGCACAAAATGGCAGG + Intergenic
987178837 5:15345397-15345419 AGTGATTTGCCCAAGATGTTAGG + Intergenic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
991049003 5:62252928-62252950 AGTAATTAGCTCATGATGGTTGG - Intergenic
991431638 5:66553858-66553880 AGTAATTTGCCCAAAGTTGCAGG + Intergenic
992629502 5:78666863-78666885 AGTTATTGGCTCAAGGCGGCAGG - Intronic
992853328 5:80833807-80833829 AGTAAAGTGCCTAAGATGGCTGG - Intronic
994371033 5:98968087-98968109 AGTAATTGGCCTATGATGGTGGG - Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
998675691 5:144405394-144405416 AGTAATTTGCCAAACATTGCAGG - Intronic
1008658074 6:53636250-53636272 ATGTATTTGCCCAAGATGGCAGG + Intergenic
1008860081 6:56138553-56138575 AGAAATTGTCCCAAGAAGGAGGG + Intronic
1008941749 6:57053933-57053955 AGTAATGGGACCAAGATGGGCGG + Exonic
1010367910 6:75073619-75073641 AGTAACTGAACCAAGTTGGCAGG - Intergenic
1017720649 6:157240996-157241018 AGCAATTACCCCAAGCTGGCCGG - Intergenic
1021074107 7:16279455-16279477 AGTAATTTGCCCAAGACTACAGG + Intronic
1021474889 7:21049823-21049845 AGCAATAGGGACAAGATGGCAGG - Intergenic
1022138304 7:27469580-27469602 AGGAATTGGCTCACGAAGGCTGG - Intergenic
1028384699 7:90241986-90242008 AGTAATTCACCCAAGATGGCTGG + Intergenic
1030947007 7:115736145-115736167 AGTAATTGAACTAAGTTGGCAGG - Intergenic
1031606273 7:123771872-123771894 AGTACATTGCCCAAGATGGAGGG + Intergenic
1032168365 7:129563592-129563614 AGGACTTGGCCCAAGACTGCTGG - Intergenic
1033765339 7:144483337-144483359 AATACTTGGCCCAACATTGCTGG + Intronic
1034364309 7:150533487-150533509 TGCAATTAGCCCAAGATGGAGGG + Intergenic
1041479982 8:58309066-58309088 AGAAATGGGTCCTAGATGGCTGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1048131765 8:131705499-131705521 GGTGGTTGGCCCAAGGTGGCTGG + Intergenic
1048553212 8:135453292-135453314 ATGAATTGGCCTCAGATGGCTGG + Intergenic
1049021424 8:139960103-139960125 AGTATCTTGCCCAAGATGGATGG + Intronic
1049256792 8:141618473-141618495 TCTAATTGGCCCAAGCTGGGTGG + Intergenic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054863616 9:69977652-69977674 AGTATTTTGCCAAAGATAGCAGG - Intergenic
1054924477 9:70575738-70575760 AGTAACTTGCCCAAGGTCGCAGG + Intronic
1055218669 9:73899939-73899961 AGCTTTTGGCCCAAGATGGGTGG + Intergenic
1055802695 9:80057676-80057698 ACTCATTGGCCCAGGATGACTGG - Intergenic
1059368548 9:113806530-113806552 AGTAATTTGCCCAAGGTCACAGG + Intergenic
1060110203 9:120901527-120901549 AGTGCTTGGCCCAAGGAGGCAGG - Intergenic
1060440020 9:123629620-123629642 AGTGACTTGCCCAAGATGGTAGG + Intronic
1060623434 9:125088850-125088872 CTTATTTGGCCCAAAATGGCAGG - Intronic
1061766484 9:132884717-132884739 GGTAACTGCCCCAAGATGGGTGG + Intronic
1062697682 9:137883868-137883890 AGTGACTGCCCCAAGATGCCTGG + Intronic
1186958512 X:14709263-14709285 AGTATTTGGCACATGATGGGGGG - Intronic
1187210712 X:17228706-17228728 AAAAATTGGCGCATGATGGCGGG + Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1194303147 X:92211370-92211392 AGTAATTGGATCATGGTGGCGGG - Intronic
1195777133 X:108419746-108419768 ACTAAATAGCACAAGATGGCAGG + Intronic
1196062531 X:111426584-111426606 AGAAATTTGAACAAGATGGCAGG + Intergenic
1199280720 X:145996469-145996491 AGAAAATGGAACAAGATGGCCGG - Intergenic
1199443920 X:147899424-147899446 AGTAACTTGCCCAAGAAGACTGG + Intergenic