ID: 1172188101

View in Genome Browser
Species Human (GRCh38)
Location 20:33044089-33044111
Sequence TCTCCTCCATGGGGTGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 6, 3: 27, 4: 269}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172188101_1172188117 22 Left 1172188101 20:33044089-33044111 CCACCTGCACCCCATGGAGGAGA 0: 1
1: 0
2: 6
3: 27
4: 269
Right 1172188117 20:33044134-33044156 GCCTGGCCCCCTACCACTGGTGG 0: 1
1: 0
2: 0
3: 14
4: 141
1172188101_1172188107 -4 Left 1172188101 20:33044089-33044111 CCACCTGCACCCCATGGAGGAGA 0: 1
1: 0
2: 6
3: 27
4: 269
Right 1172188107 20:33044108-33044130 GAGACCCCCTGATTGGAGCCAGG 0: 1
1: 0
2: 1
3: 9
4: 109
1172188101_1172188116 19 Left 1172188101 20:33044089-33044111 CCACCTGCACCCCATGGAGGAGA 0: 1
1: 0
2: 6
3: 27
4: 269
Right 1172188116 20:33044131-33044153 TGGGCCTGGCCCCCTACCACTGG 0: 1
1: 0
2: 0
3: 17
4: 200
1172188101_1172188108 -1 Left 1172188101 20:33044089-33044111 CCACCTGCACCCCATGGAGGAGA 0: 1
1: 0
2: 6
3: 27
4: 269
Right 1172188108 20:33044111-33044133 ACCCCCTGATTGGAGCCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 141
1172188101_1172188110 0 Left 1172188101 20:33044089-33044111 CCACCTGCACCCCATGGAGGAGA 0: 1
1: 0
2: 6
3: 27
4: 269
Right 1172188110 20:33044112-33044134 CCCCCTGATTGGAGCCAGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 116
1172188101_1172188114 5 Left 1172188101 20:33044089-33044111 CCACCTGCACCCCATGGAGGAGA 0: 1
1: 0
2: 6
3: 27
4: 269
Right 1172188114 20:33044117-33044139 TGATTGGAGCCAGGTGGGCCTGG 0: 1
1: 0
2: 1
3: 22
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172188101 Original CRISPR TCTCCTCCATGGGGTGCAGG TGG (reversed) Intergenic
900363212 1:2299885-2299907 ACTCCCCCATGGGGAGCTGGTGG + Intronic
900458245 1:2787591-2787613 TCTCCTCCAGGCGGCCCAGGCGG + Exonic
900703741 1:4063260-4063282 CCTCCTCCATGGGCTGAACGTGG - Intergenic
901153809 1:7122302-7122324 ACTCATCCCTGGGGTGCACGTGG - Intronic
901416396 1:9119725-9119747 TCTCCTCCATGAGCTGGTGGAGG - Intronic
901646284 1:10718487-10718509 TGCCCTCCTTGGGGAGCAGGTGG - Intronic
902773932 1:18662158-18662180 TCTCCTCCCAGGCCTGCAGGAGG - Intronic
904090539 1:27941897-27941919 CCACCTCCTTGGGGTCCAGGTGG - Intronic
906380904 1:45331736-45331758 TCTCCTCCCTGGGGGGCTTGCGG + Exonic
906811284 1:48829530-48829552 TCTGCCCTATGGGGTGAAGGAGG + Intronic
909402798 1:75252982-75253004 GCTCTCTCATGGGGTGCAGGTGG - Intronic
910470886 1:87551692-87551714 TATCCACCATGGTGTGGAGGAGG + Intergenic
913255657 1:116950866-116950888 TCTCTTGCATGGGGTTCAGACGG - Intronic
916553050 1:165867999-165868021 TCTGATCCATGGGCTGCAGAAGG + Intronic
917212473 1:172644573-172644595 TCTCCTACCTGAGGTTCAGGAGG + Intergenic
918307198 1:183258102-183258124 TCTCCTCCATGGGCTCCTGTAGG - Intronic
919804207 1:201371205-201371227 CCACCTGCCTGGGGTGCAGGGGG + Intronic
920202234 1:204266590-204266612 TTCCCTCCTTGGGGTTCAGGTGG + Intronic
920502571 1:206494491-206494513 TCCCCTCCTTGGGGTGCTGAGGG + Intronic
922620151 1:226983984-226984006 TATCCTGCCTGGGGTGAAGGAGG + Intronic
922807308 1:228397106-228397128 TCTCCTGGAGGGGGGGCAGGAGG - Intronic
1067944332 10:50680841-50680863 TCCCCTGCCTGGGGTGTAGGTGG + Intergenic
1068577182 10:58697797-58697819 TCTCCTGCAGGGGGTGTGGGTGG - Intronic
1069800942 10:71081070-71081092 CATTCTCCCTGGGGTGCAGGAGG + Intergenic
1070879625 10:79845843-79845865 TCCCCTGCCTGGGGTGTAGGTGG + Intronic
1071076465 10:81759441-81759463 TCTTCTCCATGGTGGCCAGGTGG - Intergenic
1071329961 10:84549311-84549333 CCTCTTCCATGGGGTACAGATGG + Intergenic
1071600920 10:86958384-86958406 TGCCCTCCATGGGCTGGAGGGGG - Intronic
1071632731 10:87229933-87229955 TCCCCTGCCTGGGGTGTAGGTGG + Intronic
1071646180 10:87362151-87362173 TCCCCTGCCTGGGGTGTAGGTGG + Intronic
1073204623 10:101762355-101762377 TATCTTCCCTGGGGTGCTGGGGG - Intergenic
1075970947 10:126651896-126651918 TCTCCTCCAAGGGATGTAGGAGG + Intronic
1076626211 10:131823326-131823348 TCTCCTGTGGGGGGTGCAGGCGG - Intergenic
1076674571 10:132141392-132141414 TCTTCTCCCTGGGGTGACGGGGG + Intronic
1076728039 10:132422362-132422384 TCTCCTCCGTGGGGGGGTGGGGG - Intergenic
1077210745 11:1370006-1370028 GCTCCTCCATGGGGCTCATGGGG - Intergenic
1077212998 11:1382173-1382195 TCACCTCCATTGGGTGCAGCAGG + Intergenic
1077490581 11:2859154-2859176 TCTCCTCCACGAGGTGCTTGGGG - Intergenic
1078915064 11:15771106-15771128 TTTCCTCACTTGGGTGCAGGTGG + Intergenic
1079360784 11:19768616-19768638 TGGACTCCATGGGGTGGAGGAGG + Intronic
1079430842 11:20387389-20387411 TCTCCTCCTTGGGTTGCGGCAGG - Intergenic
1081864237 11:46350956-46350978 TCTCCTCCCTGAGGAGGAGGAGG + Intronic
1083800045 11:65041373-65041395 CCACCTCCAAGCGGTGCAGGCGG - Exonic
1084001948 11:66300671-66300693 CCTCCCTCATGAGGTGCAGGTGG - Intergenic
1084537349 11:69764843-69764865 CCTCCTACATGGGGTCCTGGGGG + Intergenic
1086804913 11:91228695-91228717 TCTCCTCTATGTCCTGCAGGAGG + Intergenic
1087399788 11:97651320-97651342 TCTCCTCCAAGGTGGGCAGTGGG - Intergenic
1088754363 11:112873407-112873429 TCTCCCTCATGGGTTGCATGTGG - Intergenic
1088804364 11:113338645-113338667 TCTCCTGCACTGGGAGCAGGAGG + Intronic
1089134030 11:116235130-116235152 TCCCCTCCATTGAGTTCAGGAGG - Intergenic
1089137525 11:116261802-116261824 TCCCCTCCATCTGGTGCCGGGGG + Intergenic
1089189052 11:116641166-116641188 TGTCCTCCATGTGGGGCAGGAGG - Intergenic
1089680850 11:120118110-120118132 TCTCCTCCACGAGGTGAGGGAGG + Intronic
1090874687 11:130778247-130778269 TGTGCCCCATGGCGTGCAGGGGG - Intergenic
1091296218 11:134475690-134475712 CCACCTCCACAGGGTGCAGGGGG - Intergenic
1091740788 12:2959311-2959333 TCTCCTCCCCGAGGTGCCGGTGG + Intronic
1091795530 12:3295577-3295599 TCTCCACCCTGGGCAGCAGGAGG + Intergenic
1091835521 12:3583039-3583061 TCTCTTCTCTGGGCTGCAGGAGG + Exonic
1091996223 12:4996272-4996294 TCACCTCTATGGAGAGCAGGAGG + Intergenic
1092401497 12:8182517-8182539 TGTCCTCCAGAGGCTGCAGGAGG + Intronic
1092821275 12:12355865-12355887 ACTCCTCCATGGTCAGCAGGTGG - Intergenic
1093914997 12:24791800-24791822 TCACCTACATGGGTTGCATGTGG + Intergenic
1097918179 12:65041980-65042002 TCTCCTCCATTGGGTGACGGAGG - Intergenic
1099755029 12:86834772-86834794 TCTCCTCATTGGTGTGTAGGCGG + Intronic
1101432963 12:104641920-104641942 TGTCCTCCCTGGGGTGGATGGGG - Intronic
1101572178 12:105963816-105963838 TCTCATCCATGGGGTCCAGAGGG - Intergenic
1101614131 12:106319457-106319479 GCTACTCCAGGAGGTGCAGGGGG - Intronic
1101765692 12:107697130-107697152 CCTCCTTCATGGGGTGCTGTGGG - Intronic
1102181448 12:110915651-110915673 TCACATCCATGAGGAGCAGGAGG - Intronic
1102534527 12:113570646-113570668 TCACCTCCAGGGTGGGCAGGGGG + Intergenic
1103266624 12:119636082-119636104 TGTCCTCCCTGGAGTCCAGGGGG + Intronic
1103848784 12:123917771-123917793 TCTCCTCCAGGGTGTGCACCAGG - Exonic
1104217407 12:126747724-126747746 TCCCCTCCATGGCCAGCAGGGGG - Intergenic
1104390230 12:128385872-128385894 TCTGCTCCATGAGTTGCTGGTGG + Intronic
1104971830 12:132534234-132534256 TGGCCTCCATGGGCTGCGGGAGG + Intronic
1105255470 13:18741661-18741683 TCTGCTCCAGGTGGTGAAGGGGG - Intergenic
1107329535 13:39284069-39284091 TCTGCTGCATGGGGTAAAGGAGG + Intergenic
1112425082 13:99290819-99290841 TCTCATTCATGGGATTCAGGTGG - Intronic
1113915174 13:113866330-113866352 TCACCTCCACAGGGGGCAGGAGG + Intergenic
1117564550 14:56979540-56979562 TCTCCTCCATGGTCTGCAAGCGG - Intergenic
1118753403 14:68822203-68822225 CATCCTGGATGGGGTGCAGGTGG - Intergenic
1118812015 14:69282164-69282186 TCGCCTCCAGGGGATGCGGGTGG - Intronic
1119647302 14:76357003-76357025 CCTCCCCCAGGGGGTGCATGTGG - Intronic
1122039375 14:98972938-98972960 TCTCCTCCATGGTCTGGAAGCGG + Intergenic
1122354766 14:101116191-101116213 TCTCATCCCAGGGCTGCAGGAGG + Intergenic
1123126786 14:105952540-105952562 TCCCCTCCAGAGGGTCCAGGAGG - Intergenic
1124887727 15:33702504-33702526 TTTCCTCCAAGGAGTGCAGGAGG + Intronic
1125360330 15:38857963-38857985 TCTCCTCCCAGGGAGGCAGGTGG - Intergenic
1126574464 15:50183485-50183507 TCTTCTCCCTGGGGATCAGGTGG - Intronic
1129779807 15:78263362-78263384 TCTCCTCCATGTGTTCCATGGGG - Intergenic
1131121408 15:89825251-89825273 CCACCCCCATGGGGAGCAGGAGG - Intergenic
1132679090 16:1132433-1132455 TCTGCCCCACGGGGAGCAGGAGG - Intergenic
1132933235 16:2469117-2469139 CCTCCTCCCTGGGGAGCTGGCGG + Intergenic
1133019815 16:2962507-2962529 TCTCCTCCAGAGGGGGCAGGGGG - Intergenic
1136077052 16:27824364-27824386 TCTCCTCCACGGGGGACAGAGGG - Intronic
1136344029 16:29663743-29663765 CCTTCTCCTTGGGGTGCTGGTGG + Exonic
1138217535 16:55217722-55217744 TCACCTTCCTTGGGTGCAGGTGG - Intergenic
1138584185 16:57959970-57959992 GTTCCTCCTTGGGCTGCAGGGGG + Exonic
1139589547 16:67925994-67926016 TGCCCTCCAGGGGGTTCAGGAGG - Intronic
1141204527 16:81923380-81923402 TCTTCTCATTGGGGAGCAGGAGG - Intronic
1141526523 16:84615315-84615337 TCCCATCCCTGGGGGGCAGGAGG + Intronic
1141739520 16:85881626-85881648 TCTCCTTCAGGGCATGCAGGAGG - Intergenic
1141925964 16:87169749-87169771 TCTCCGCCATGAGGAGCTGGTGG - Intronic
1142259532 16:89036313-89036335 TCTGCTCCATGAGGGCCAGGTGG + Intergenic
1142399456 16:89851737-89851759 TCTCCTCCATGAGATGCTGACGG - Intronic
1143225666 17:5300504-5300526 TCTCTTTCTTGGGGTGCAAGCGG + Intronic
1143371597 17:6444106-6444128 TCTGACCCATGGGGTGGAGGCGG - Intergenic
1143782145 17:9234507-9234529 GCTCCACCATGGGGAGGAGGCGG - Intronic
1144888495 17:18479641-18479663 TTTGCTCCGTAGGGTGCAGGAGG - Intronic
1145143711 17:20464661-20464683 TTTGCTCCGTAGGGTGCAGGAGG + Intronic
1145792137 17:27633984-27634006 TTTGTTCCATGTGGTGCAGGAGG - Intronic
1147965211 17:44190981-44191003 TCTCCTCCATAGGACACAGGAGG + Exonic
1148473913 17:47914600-47914622 ACTCCTCTATGGTGGGCAGGGGG - Intronic
1150283202 17:63941172-63941194 TCTCCTCCATGGTCTGCTTGAGG + Exonic
1150327515 17:64268736-64268758 TCTCCAAGATGGGGGGCAGGGGG + Intergenic
1150804848 17:68310628-68310650 ACTCCTCCATGTGGTTCGGGGGG + Intronic
1150992493 17:70275983-70276005 TCTTCTGCCTGGGGTTCAGGTGG + Intergenic
1153927017 18:9843191-9843213 TGCCCACAATGGGGTGCAGGAGG - Intronic
1154435550 18:14338943-14338965 TCTGCTCCAGGTGGTGAAGGGGG + Intergenic
1155329316 18:24698756-24698778 TCTCCTCCTTGGCTTGCAGATGG - Intergenic
1156461830 18:37325601-37325623 CCTCCTCCATGGCGTGCTGTTGG + Intronic
1159359359 18:67381169-67381191 TCTCCTCCATGCGGTGACTGTGG + Intergenic
1161221248 19:3119199-3119221 TCTCCTCCATCCGGTTCTGGCGG - Exonic
1161469108 19:4447588-4447610 TCTCCTCCTCGGGGTGCAGGTGG + Exonic
1162020662 19:7867016-7867038 CCACCTCCCAGGGGTGCAGGTGG + Intergenic
1162027054 19:7900367-7900389 TTTCCTCGATGGAGCGCAGGTGG - Exonic
1164348986 19:27309217-27309239 TCTCCACCATAGGCTGCAAGGGG - Intergenic
1166617177 19:44260580-44260602 TCACCTCCATGTGGTGCCTGGGG + Intronic
1166925667 19:46265425-46265447 GCTCCCCCATGTGGTGGAGGGGG + Intergenic
1167794051 19:51697650-51697672 TCTCCTCCAGAGGGAGCAGCAGG + Intergenic
926283024 2:11465819-11465841 TCTCCTCCGTCGGGTCCAGGAGG + Exonic
927325690 2:21802481-21802503 TCTTCTCCATGTCTTGCAGGTGG - Intergenic
927481236 2:23456007-23456029 TCTTCTCCTTGGCTTGCAGGTGG - Intronic
929337853 2:40772630-40772652 ACTTCTCCATGGTGTGTAGGTGG - Intergenic
929593498 2:43161681-43161703 TCTCCTCCATCAGGTGTAGGGGG + Intergenic
932187877 2:69714263-69714285 TCCACTCCATGGGGTTCTGGTGG - Intronic
932781552 2:74561687-74561709 TCTCCTCTCTGGGGAGGAGGTGG + Intronic
934935085 2:98459473-98459495 TCTCCTCCTTGGTGTGCAACTGG + Intronic
935755870 2:106275915-106275937 ACTCCACCTTGGGGTGGAGGTGG - Intergenic
937321070 2:120961101-120961123 TCTTCTCAATGTGGTGGAGGGGG - Intronic
938101019 2:128498319-128498341 TCCCAAGCATGGGGTGCAGGGGG + Intergenic
938278391 2:130048357-130048379 TCTGCTCCAGGTGGTGAAGGGGG - Intergenic
938360581 2:130682287-130682309 TCTGCTCCAGGTGGTGAAGGGGG + Intergenic
938436984 2:131288995-131289017 TCTGCTCCAGGTGGTGAAGGGGG + Intronic
938568273 2:132539994-132540016 TTTCCTCTGTGGGGTGCAGATGG - Intronic
939715386 2:145577790-145577812 TCTACTCCATGGGGCTGAGGTGG + Intergenic
941666585 2:168248204-168248226 TCGCCTCCCTGGGATCCAGGCGG - Intergenic
944011702 2:194981542-194981564 CCTCCTCCATGGGATGGGGGTGG + Intergenic
948824235 2:240566645-240566667 CCCGCTCCATGGGGTGCAGTAGG + Intronic
948897547 2:240934337-240934359 TCTCCTCCAGCTGCTGCAGGCGG - Intronic
1168861242 20:1047476-1047498 TCTCCTCCATGTGGTGATGCAGG - Intergenic
1169315643 20:4588338-4588360 ACTCCTCCTGGGGGTGCAGAGGG - Intergenic
1171241272 20:23568873-23568895 TCTCTTCGACGGGGTGAAGGAGG - Intergenic
1171821507 20:29848557-29848579 TTTCCACCATGGGGTGCAAAGGG - Intergenic
1171880277 20:30613607-30613629 TCTGCTCCAGGTGGTGAAGGGGG - Intergenic
1172188101 20:33044089-33044111 TCTCCTCCATGGGGTGCAGGTGG - Intergenic
1172948045 20:38703641-38703663 TCTCCTCCAGGGCATGCAGCAGG - Intergenic
1173055097 20:39604264-39604286 TCTTCTGCATGAGGTGCATGAGG - Intergenic
1173306543 20:41856050-41856072 TCTCCTGTGTGGGTTGCAGGAGG + Intergenic
1174406156 20:50304666-50304688 TCATCTCCATGGAGTGGAGGAGG + Intergenic
1174576899 20:51543053-51543075 TCTTCTCCATGGGGTGGAAGGGG + Intronic
1175247462 20:57590501-57590523 TCTGCTCTATGGGCTGCAGGAGG - Intergenic
1175890811 20:62315109-62315131 TCTCCTGCATGGCCTGCAGCTGG + Exonic
1176476413 21:7216797-7216819 TTTCCTCCATGGGCTGCAAAGGG + Intergenic
1176841482 21:13846690-13846712 TCTGCTCCAGGTGGTGAAGGGGG - Intergenic
1178052541 21:28763871-28763893 TCTGCTCCATGTGGTCCATGTGG - Intergenic
1178148638 21:29768652-29768674 TCTGCAGCATGGGGTTCAGGTGG - Intronic
1178400507 21:32281093-32281115 ACTTCTCCATGATGTGCAGGAGG - Intergenic
1178489033 21:33036318-33036340 TCTCCTCAATGGGGGGATGGGGG - Intergenic
1178845219 21:36169029-36169051 TCTCCTCCATGGTCTGGAAGCGG + Intronic
1179802311 21:43816745-43816767 TCTCCTGCATGGCCTGCAGGAGG + Intergenic
1179979536 21:44888972-44888994 TGTCCACCAGGGGGGGCAGGTGG + Intronic
1180164957 21:46020480-46020502 TCTGCTACATGGGGTGCTGGCGG - Intergenic
1180403633 22:12522950-12522972 TTTCCTCCATGGGCTGCAAAGGG - Intergenic
1180821772 22:18833734-18833756 TCTCCTCCGTCGGGTGCAGGAGG - Intergenic
1180956509 22:19743702-19743724 GCTCCACCCTGGGGTGCTGGGGG - Intergenic
1181191205 22:21142311-21142333 TCTCCTCCGTCGGGTGCAGGAGG + Intergenic
1181207994 22:21268199-21268221 TCTCCTCCGTCGGGTGCAGGAGG - Intergenic
1181462754 22:23095086-23095108 TCTCCTCCATGGGGCGCTGTAGG - Intronic
1182143230 22:27980615-27980637 TCTGCTCCATGTGCTGCTGGTGG + Exonic
1183057086 22:35313655-35313677 TCATCTCCATGAGGGGCAGGTGG + Intronic
1183343256 22:37293735-37293757 TGTCCTTCAGGGGGTGCTGGTGG + Intronic
1183487762 22:38098440-38098462 TCTTCTCCATGTGCTGCAGCAGG + Exonic
1183605188 22:38863817-38863839 TCTCCCCCATAGGGTGGCGGTGG + Exonic
1183678517 22:39313205-39313227 TCTCCTCCATGGTCTGGAAGCGG + Exonic
1184264134 22:43337737-43337759 ACTCCTCCCTGGGATGCTGGTGG - Intronic
1184389210 22:44193183-44193205 TCTCTTCTATGGGGTAGAGGTGG + Intronic
1203218928 22_KI270731v1_random:27217-27239 TCTCCTCCGTCGGGTGCAGGAGG + Intergenic
1203271899 22_KI270734v1_random:59610-59632 TCTCCTCCGTCGGGTGCAGGAGG - Intergenic
949340406 3:3023754-3023776 TTTCTGCCATGGGGTGCAGATGG - Intronic
950108516 3:10403680-10403702 TCCCCTCCACGGGGGCCAGGTGG + Intronic
950117500 3:10460887-10460909 TTTCCTCCATGGGGTGAGGGAGG + Intronic
950144236 3:10636363-10636385 CCTCCTTCCTGGGCTGCAGGAGG + Intronic
952857714 3:37785861-37785883 TCTCCTCCATAAAGTGCAGTTGG + Intronic
952926875 3:38326680-38326702 TCTCCTCCATGGGGCCCACAGGG + Intergenic
953418179 3:42734808-42734830 TCACCTCCCTGGGGTGGTGGTGG - Intronic
953885481 3:46712438-46712460 TCTGCTCCATGGAGGGCACGTGG - Exonic
953983728 3:47426069-47426091 TCTCCTCCTTGAAGTGCACGTGG + Exonic
954136035 3:48582641-48582663 TCTCCTCCAGGGGCTGCCAGGGG - Exonic
955235382 3:57134660-57134682 TCTCCTCCTTGGCCTGTAGGCGG - Intronic
955341945 3:58131672-58131694 TCTCCTTCATGGGGTTCAGCAGG + Intronic
956384310 3:68700837-68700859 TCCCCTACCTGGGGTGCATGAGG + Intergenic
956458043 3:69443147-69443169 TCCCCTCCCTGGGGGTCAGGGGG - Intronic
956657129 3:71563216-71563238 GCTACTCTATGGGGTGCAGTAGG + Intronic
956742930 3:72289158-72289180 CCTCCTCCCTGGGCTGCTGGGGG + Intergenic
961542147 3:127607259-127607281 TCTCCTGAATATGGTGCAGGAGG - Intronic
963038757 3:141053128-141053150 TCTCCTCCTTGGGGGGTTGGGGG + Intronic
963317154 3:143771910-143771932 TCTCCTCCAGGTTGAGCAGGAGG + Intronic
967936176 3:194729596-194729618 TCTCCTGTATGGGGTGGGGGTGG + Intergenic
968088626 3:195886024-195886046 TCACCTCCCGGGGCTGCAGGAGG - Intronic
968554324 4:1239578-1239600 TCTCTGCCATGGGTTCCAGGAGG - Intronic
968659318 4:1792682-1792704 TGTCCTCCTTGGGGGGCGGGGGG + Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969183107 4:5456880-5456902 ACTCCTCCACGTGGTGCAAGGGG + Exonic
969239720 4:5890393-5890415 GCTTCTCCCTGGGCTGCAGGAGG - Intronic
969301668 4:6300668-6300690 TCTCCATGATGGCGTGCAGGGGG - Exonic
969327066 4:6450208-6450230 TCTCATCTATGGGGTGGAGTGGG + Intronic
973742444 4:53931119-53931141 TCTCCAGCCTGGGCTGCAGGGGG + Intronic
979358963 4:119739258-119739280 TCTCATCCATGGTGAGCAGAAGG - Intergenic
981724125 4:147830013-147830035 TCTCATCCTGGGGGTGCTGGGGG + Intronic
984409028 4:179371489-179371511 TCTCCTTAATGGGGGGCTGGTGG - Intergenic
985563068 5:601748-601770 TCTCTTCCTTGGGGTGCTGGGGG + Intergenic
985641622 5:1065954-1065976 TCTCCTCCCGGGGTTGGAGGGGG + Intronic
988621493 5:32828240-32828262 TCTTGTCCCTGGGGTGCAGAGGG - Intergenic
990631824 5:57678884-57678906 TCTCGTCAATGGGGTGTGGGCGG + Intergenic
992641772 5:78773941-78773963 TCTCCTCCACGGGCCTCAGGAGG - Intergenic
997242825 5:132320554-132320576 TCTCCAACATGGGATGCAGGAGG + Intronic
997900746 5:137761824-137761846 TCTCCTCCTTGGCTTGCAGATGG - Intergenic
998170019 5:139867268-139867290 TCTCCCCCAGGGGAGGCAGGAGG + Intronic
998463057 5:142323673-142323695 TCTCCTTGATTGGGGGCAGGGGG - Intronic
999710055 5:154310104-154310126 TCTGCACCATGGGGTGGGGGCGG - Intronic
1001328796 5:170747905-170747927 TCCCCTCCCTGGGGTGGAGTGGG - Intergenic
1001853147 5:174986948-174986970 TCTCTTCCTTGGCTTGCAGGTGG - Intergenic
1002842173 6:915605-915627 TCACCTTCCAGGGGTGCAGGTGG - Intergenic
1004186078 6:13422371-13422393 TTTCCTCCACGGGGTGGATGGGG - Intronic
1004427052 6:15513676-15513698 CTTCCTCCCTGGGGAGCAGGTGG + Intronic
1005870356 6:29970828-29970850 TCTGCTCCATGGGATACAGCAGG - Intergenic
1005923162 6:30418334-30418356 TCTTCTCCCTGTGGAGCAGGGGG - Intergenic
1005956957 6:30670949-30670971 TCCCCTGGATGGGCTGCAGGGGG - Exonic
1006044326 6:31281438-31281460 TCTCCTCCATGGTCTGGAAGCGG - Intronic
1006164239 6:32055265-32055287 TATGCTCCATGCAGTGCAGGAGG - Intronic
1006275277 6:33000268-33000290 TCTCCTCCTTGTGGTTTAGGAGG - Intergenic
1006452267 6:34112055-34112077 TCTCCTCCCTGGGCTGAAGCAGG - Intronic
1006845678 6:37059830-37059852 TCTTCTCCACAGGGAGCAGGAGG - Intergenic
1007541060 6:42645022-42645044 TCTGCTCTATGGACTGCAGGGGG - Intronic
1007601761 6:43086432-43086454 TCTCCTCCTTGGGGTGGTGGCGG + Intronic
1007702477 6:43772978-43773000 TTTCCTCCTTGGGGCCCAGGAGG + Intronic
1009353473 6:62709855-62709877 TCTCCTCAAGGGGATGGAGGTGG + Intergenic
1012264406 6:97123687-97123709 TATCCTCCCTGGGGTGGGGGAGG + Intronic
1015526000 6:134175652-134175674 TCTCCCCCATGGGCAGCGGGCGG + Intronic
1018925857 6:168206545-168206567 TCTCCTGCTTGGAGAGCAGGGGG + Intergenic
1019307843 7:344290-344312 TCTCCGACATGGGGGGCAGGTGG + Intergenic
1019407400 7:890815-890837 TCTCCTCCAGGGCGGGCAGGTGG + Intronic
1020014391 7:4822343-4822365 TCCCCTGCCTGGGGTGCTGGCGG + Intronic
1022384014 7:29884983-29885005 TCTCCTCCCTGAGGTGGAGGGGG + Intronic
1023834078 7:44058336-44058358 TCGCCTCCATGGGATGGAGCAGG - Intronic
1024976977 7:55122397-55122419 TGTCCTCAATGGGCTGCTGGTGG + Intronic
1025209344 7:57011900-57011922 CATCCTCCCTGGGGTCCAGGTGG - Intergenic
1025662601 7:63564954-63564976 CATCCTCCCTGGGGTCCAGGTGG + Intergenic
1028747616 7:94345963-94345985 TCTCCTTCATAGGCTGGAGGTGG - Intergenic
1030473473 7:109998479-109998501 TCTCCTCCATGGTCTGGAAGTGG + Intergenic
1033332774 7:140429881-140429903 TCTCCTCCTGGGGGTGAAGGAGG - Intergenic
1033372161 7:140719018-140719040 TTTCCTCCATGTGGTTCAGTTGG - Intronic
1036215729 8:6878219-6878241 TCTCCTCCATGTGATCCAGAAGG - Intergenic
1036345290 8:7957320-7957342 TGTCCTCCAGAGGCTGCAGGAGG + Intergenic
1036862422 8:12364332-12364354 TGTCCTCCAGAGGCTGCAGGAGG + Intergenic
1037601153 8:20395285-20395307 TCTCCTCCAAGCAGAGCAGGTGG - Intergenic
1045004217 8:97903184-97903206 TCTGCTCTGAGGGGTGCAGGTGG + Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045232852 8:100321734-100321756 TTTCATCCATGGGCTGCAGATGG + Intronic
1045494744 8:102698897-102698919 CCTCCTCCAGGGGCTGCAGTGGG - Intergenic
1045959244 8:107947904-107947926 TCACCTCCCTTGGGTGCATGAGG + Intronic
1047230616 8:122995268-122995290 TCTCCTGTATGGAGGGCAGGTGG + Intergenic
1048328532 8:133456580-133456602 ACTCATCCCTGGGGTGAAGGTGG - Exonic
1048337084 8:133510810-133510832 TGGCCACCATGGGGTACAGGAGG - Intronic
1049040665 8:140110252-140110274 GCTGCTGCAGGGGGTGCAGGGGG - Intronic
1049040784 8:140110686-140110708 GCTGCTGCAGGGGGTGCAGGGGG - Intronic
1049040857 8:140110905-140110927 GCTGCTGCAGGGGGTGCAGGGGG - Intronic
1049755725 8:144310551-144310573 TCTCCTGCATGGGGTCTAGCAGG + Intronic
1053345480 9:37375052-37375074 CCTCCTCCTTGGCTTGCAGGTGG - Intergenic
1053415069 9:37942310-37942332 TCTCCTCCAAGGAGGGAAGGAGG - Intronic
1057036862 9:91817546-91817568 TCTCCTCCGGGGAGTGAAGGGGG + Intronic
1059218087 9:112585516-112585538 TGTCCTCCACGGGGCTCAGGGGG + Intronic
1059454293 9:114389938-114389960 TCTGCTCCATGTGGGGCTGGGGG - Intronic
1061818063 9:133207974-133207996 TCTCCTTCCTGGGGGGCTGGTGG - Intronic
1061855606 9:133440462-133440484 TCTCCTCCAGGCGGGGCAGCCGG - Exonic
1062171107 9:135135277-135135299 TCTCTTCCATAGGGTGCCGCAGG + Intergenic
1062242391 9:135547380-135547402 TCTCCTTCCTGGGGGGCTGGTGG + Intronic
1062400298 9:136369863-136369885 TCTCCTCCATGCACTGCAGGGGG + Exonic
1203372819 Un_KI270442v1:326750-326772 TTTCCACCATGGGGTGCAGAGGG - Intergenic
1203411847 Un_KI270579v1:19483-19505 TTTCCTCCATGGGCTGCAAAGGG + Intergenic
1187245118 X:17547011-17547033 TTTCCTCCCTGGGGTCCAGGAGG + Intronic
1188225374 X:27591380-27591402 TCTCCTCAATGGGGTAAAAGAGG - Intronic
1188823843 X:34805776-34805798 TCTCCACCATGTGCTGCTGGGGG + Intergenic
1189856902 X:45232712-45232734 TCTACTCCAAGGGGTTCTGGTGG + Intergenic
1193494696 X:82196914-82196936 TCTCCTGGCTGGGGAGCAGGGGG + Intergenic
1194688952 X:96958026-96958048 ACTCCTCCAAGGGGTGGTGGTGG - Exonic
1196920028 X:120575880-120575902 TCTCCTCCATGGGGAGGGTGAGG + Intergenic
1197243587 X:124145819-124145841 ACTCCTCCATGGGCTGCGGTTGG - Intronic
1197813405 X:130471101-130471123 TCTCCAGCATGGTGTCCAGGGGG - Intergenic
1199972996 X:152874212-152874234 TGTTCTCCATGGTGGGCAGGGGG + Intergenic
1200772908 Y:7143729-7143751 CCTCAGCCATGGGATGCAGGAGG + Intergenic
1200835600 Y:7728297-7728319 GCTACTCCATGAGGTGCAGCAGG + Intergenic