ID: 1172189041

View in Genome Browser
Species Human (GRCh38)
Location 20:33050470-33050492
Sequence GGTGTGTCAGAGTCCCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172189031_1172189041 25 Left 1172189031 20:33050422-33050444 CCTGGCTTTGGTGCATGAGGGGA No data
Right 1172189041 20:33050470-33050492 GGTGTGTCAGAGTCCCCTGTTGG No data
1172189040_1172189041 -8 Left 1172189040 20:33050455-33050477 CCTGGGGAGCTTATGGGTGTGTC No data
Right 1172189041 20:33050470-33050492 GGTGTGTCAGAGTCCCCTGTTGG No data
1172189027_1172189041 30 Left 1172189027 20:33050417-33050439 CCTGACCTGGCTTTGGTGCATGA No data
Right 1172189041 20:33050470-33050492 GGTGTGTCAGAGTCCCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172189041 Original CRISPR GGTGTGTCAGAGTCCCCTGT TGG Intergenic