ID: 1172189785

View in Genome Browser
Species Human (GRCh38)
Location 20:33054979-33055001
Sequence CTCTCATCCTGCTGTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172189778_1172189785 28 Left 1172189778 20:33054928-33054950 CCTTCTGAAACAGCCTCATGAGC No data
Right 1172189785 20:33054979-33055001 CTCTCATCCTGCTGTCCTGGAGG No data
1172189781_1172189785 15 Left 1172189781 20:33054941-33054963 CCTCATGAGCCAGTGGGAAGCAG No data
Right 1172189785 20:33054979-33055001 CTCTCATCCTGCTGTCCTGGAGG No data
1172189783_1172189785 6 Left 1172189783 20:33054950-33054972 CCAGTGGGAAGCAGCTGCTGGAA No data
Right 1172189785 20:33054979-33055001 CTCTCATCCTGCTGTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172189785 Original CRISPR CTCTCATCCTGCTGTCCTGG AGG Intergenic