ID: 1172201126

View in Genome Browser
Species Human (GRCh38)
Location 20:33126664-33126686
Sequence TTAGTAGAGAGCTATCACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172201126_1172201131 13 Left 1172201126 20:33126664-33126686 CCATGGTGATAGCTCTCTACTAA No data
Right 1172201131 20:33126700-33126722 GGATGGTCACAGTCACAGCTCGG No data
1172201126_1172201132 17 Left 1172201126 20:33126664-33126686 CCATGGTGATAGCTCTCTACTAA No data
Right 1172201132 20:33126704-33126726 GGTCACAGTCACAGCTCGGATGG No data
1172201126_1172201129 -8 Left 1172201126 20:33126664-33126686 CCATGGTGATAGCTCTCTACTAA No data
Right 1172201129 20:33126679-33126701 TCTACTAAAGGAAGATGGACAGG No data
1172201126_1172201130 -4 Left 1172201126 20:33126664-33126686 CCATGGTGATAGCTCTCTACTAA No data
Right 1172201130 20:33126683-33126705 CTAAAGGAAGATGGACAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172201126 Original CRISPR TTAGTAGAGAGCTATCACCA TGG (reversed) Intergenic
No off target data available for this crispr