ID: 1172202747

View in Genome Browser
Species Human (GRCh38)
Location 20:33138420-33138442
Sequence GGATTCTCACAGATGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172202747_1172202757 29 Left 1172202747 20:33138420-33138442 CCCTACTCCATCTGTGAGAATCC No data
Right 1172202757 20:33138472-33138494 CTTGGTCAGAGTGAGATGGGCGG No data
1172202747_1172202756 26 Left 1172202747 20:33138420-33138442 CCCTACTCCATCTGTGAGAATCC No data
Right 1172202756 20:33138469-33138491 AAACTTGGTCAGAGTGAGATGGG No data
1172202747_1172202751 1 Left 1172202747 20:33138420-33138442 CCCTACTCCATCTGTGAGAATCC No data
Right 1172202751 20:33138444-33138466 TGTGACCAATCAAGACACTATGG No data
1172202747_1172202752 2 Left 1172202747 20:33138420-33138442 CCCTACTCCATCTGTGAGAATCC No data
Right 1172202752 20:33138445-33138467 GTGACCAATCAAGACACTATGGG No data
1172202747_1172202754 11 Left 1172202747 20:33138420-33138442 CCCTACTCCATCTGTGAGAATCC No data
Right 1172202754 20:33138454-33138476 CAAGACACTATGGGTAAACTTGG No data
1172202747_1172202755 25 Left 1172202747 20:33138420-33138442 CCCTACTCCATCTGTGAGAATCC No data
Right 1172202755 20:33138468-33138490 TAAACTTGGTCAGAGTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172202747 Original CRISPR GGATTCTCACAGATGGAGTA GGG (reversed) Intergenic
No off target data available for this crispr