ID: 1172208927

View in Genome Browser
Species Human (GRCh38)
Location 20:33184089-33184111
Sequence TGGGCACACATCCTCAACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172208927_1172208934 22 Left 1172208927 20:33184089-33184111 CCAATGTTGAGGATGTGTGCCCA No data
Right 1172208934 20:33184134-33184156 CGACACGTGCTGAAGGTGATGGG No data
1172208927_1172208933 21 Left 1172208927 20:33184089-33184111 CCAATGTTGAGGATGTGTGCCCA No data
Right 1172208933 20:33184133-33184155 ACGACACGTGCTGAAGGTGATGG No data
1172208927_1172208931 15 Left 1172208927 20:33184089-33184111 CCAATGTTGAGGATGTGTGCCCA No data
Right 1172208931 20:33184127-33184149 GTCCTGACGACACGTGCTGAAGG No data
1172208927_1172208928 -10 Left 1172208927 20:33184089-33184111 CCAATGTTGAGGATGTGTGCCCA No data
Right 1172208928 20:33184102-33184124 TGTGTGCCCATGACAGTCTCAGG No data
1172208927_1172208935 23 Left 1172208927 20:33184089-33184111 CCAATGTTGAGGATGTGTGCCCA No data
Right 1172208935 20:33184135-33184157 GACACGTGCTGAAGGTGATGGGG No data
1172208927_1172208936 24 Left 1172208927 20:33184089-33184111 CCAATGTTGAGGATGTGTGCCCA No data
Right 1172208936 20:33184136-33184158 ACACGTGCTGAAGGTGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172208927 Original CRISPR TGGGCACACATCCTCAACAT TGG (reversed) Intergenic
No off target data available for this crispr