ID: 1172208929

View in Genome Browser
Species Human (GRCh38)
Location 20:33184108-33184130
Sequence GGACTTCCTGAGACTGTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172208929_1172208936 5 Left 1172208929 20:33184108-33184130 CCCATGACAGTCTCAGGAAGTCC No data
Right 1172208936 20:33184136-33184158 ACACGTGCTGAAGGTGATGGGGG No data
1172208929_1172208934 3 Left 1172208929 20:33184108-33184130 CCCATGACAGTCTCAGGAAGTCC No data
Right 1172208934 20:33184134-33184156 CGACACGTGCTGAAGGTGATGGG No data
1172208929_1172208935 4 Left 1172208929 20:33184108-33184130 CCCATGACAGTCTCAGGAAGTCC No data
Right 1172208935 20:33184135-33184157 GACACGTGCTGAAGGTGATGGGG No data
1172208929_1172208937 15 Left 1172208929 20:33184108-33184130 CCCATGACAGTCTCAGGAAGTCC No data
Right 1172208937 20:33184146-33184168 AAGGTGATGGGGGCACAGCTTGG No data
1172208929_1172208931 -4 Left 1172208929 20:33184108-33184130 CCCATGACAGTCTCAGGAAGTCC No data
Right 1172208931 20:33184127-33184149 GTCCTGACGACACGTGCTGAAGG No data
1172208929_1172208933 2 Left 1172208929 20:33184108-33184130 CCCATGACAGTCTCAGGAAGTCC No data
Right 1172208933 20:33184133-33184155 ACGACACGTGCTGAAGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172208929 Original CRISPR GGACTTCCTGAGACTGTCAT GGG (reversed) Intergenic
No off target data available for this crispr