ID: 1172208934

View in Genome Browser
Species Human (GRCh38)
Location 20:33184134-33184156
Sequence CGACACGTGCTGAAGGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172208927_1172208934 22 Left 1172208927 20:33184089-33184111 CCAATGTTGAGGATGTGTGCCCA No data
Right 1172208934 20:33184134-33184156 CGACACGTGCTGAAGGTGATGGG No data
1172208930_1172208934 2 Left 1172208930 20:33184109-33184131 CCATGACAGTCTCAGGAAGTCCT No data
Right 1172208934 20:33184134-33184156 CGACACGTGCTGAAGGTGATGGG No data
1172208929_1172208934 3 Left 1172208929 20:33184108-33184130 CCCATGACAGTCTCAGGAAGTCC No data
Right 1172208934 20:33184134-33184156 CGACACGTGCTGAAGGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172208934 Original CRISPR CGACACGTGCTGAAGGTGAT GGG Intergenic
No off target data available for this crispr