ID: 1172208937

View in Genome Browser
Species Human (GRCh38)
Location 20:33184146-33184168
Sequence AAGGTGATGGGGGCACAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172208929_1172208937 15 Left 1172208929 20:33184108-33184130 CCCATGACAGTCTCAGGAAGTCC No data
Right 1172208937 20:33184146-33184168 AAGGTGATGGGGGCACAGCTTGG No data
1172208932_1172208937 -6 Left 1172208932 20:33184129-33184151 CCTGACGACACGTGCTGAAGGTG No data
Right 1172208937 20:33184146-33184168 AAGGTGATGGGGGCACAGCTTGG No data
1172208930_1172208937 14 Left 1172208930 20:33184109-33184131 CCATGACAGTCTCAGGAAGTCCT No data
Right 1172208937 20:33184146-33184168 AAGGTGATGGGGGCACAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172208937 Original CRISPR AAGGTGATGGGGGCACAGCT TGG Intergenic
No off target data available for this crispr