ID: 1172211222

View in Genome Browser
Species Human (GRCh38)
Location 20:33199840-33199862
Sequence ATTGGATGCTCACTGAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172211222_1172211226 0 Left 1172211222 20:33199840-33199862 CCTCTCCTCAGTGAGCATCCAAT No data
Right 1172211226 20:33199863-33199885 CACAGGTAATAAACAACAACAGG No data
1172211222_1172211227 10 Left 1172211222 20:33199840-33199862 CCTCTCCTCAGTGAGCATCCAAT No data
Right 1172211227 20:33199873-33199895 AAACAACAACAGGAAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172211222 Original CRISPR ATTGGATGCTCACTGAGGAG AGG (reversed) Intergenic
No off target data available for this crispr