ID: 1172211409

View in Genome Browser
Species Human (GRCh38)
Location 20:33201124-33201146
Sequence GCCCTACAGGATCAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172211409_1172211412 -9 Left 1172211409 20:33201124-33201146 CCATCTTCCTGATCCTGTAGGGC No data
Right 1172211412 20:33201138-33201160 CTGTAGGGCCTTTTTTTTCACGG No data
1172211409_1172211415 25 Left 1172211409 20:33201124-33201146 CCATCTTCCTGATCCTGTAGGGC No data
Right 1172211415 20:33201172-33201194 TTCTATATGTATTTATTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172211409 Original CRISPR GCCCTACAGGATCAGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr