ID: 1172215782

View in Genome Browser
Species Human (GRCh38)
Location 20:33234678-33234700
Sequence CCCAGGCCTGAGGGATCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172215782_1172215793 20 Left 1172215782 20:33234678-33234700 CCAAAGGATCCCTCAGGCCTGGG No data
Right 1172215793 20:33234721-33234743 GGACCTAAAAGAGAAGCGGCGGG No data
1172215782_1172215788 -1 Left 1172215782 20:33234678-33234700 CCAAAGGATCCCTCAGGCCTGGG No data
Right 1172215788 20:33234700-33234722 GAACCTGGAAAGACTTTTCCAGG No data
1172215782_1172215796 29 Left 1172215782 20:33234678-33234700 CCAAAGGATCCCTCAGGCCTGGG No data
Right 1172215796 20:33234730-33234752 AGAGAAGCGGCGGGGCACTGTGG No data
1172215782_1172215794 21 Left 1172215782 20:33234678-33234700 CCAAAGGATCCCTCAGGCCTGGG No data
Right 1172215794 20:33234722-33234744 GACCTAAAAGAGAAGCGGCGGGG No data
1172215782_1172215792 19 Left 1172215782 20:33234678-33234700 CCAAAGGATCCCTCAGGCCTGGG No data
Right 1172215792 20:33234720-33234742 AGGACCTAAAAGAGAAGCGGCGG No data
1172215782_1172215790 16 Left 1172215782 20:33234678-33234700 CCAAAGGATCCCTCAGGCCTGGG No data
Right 1172215790 20:33234717-33234739 TCCAGGACCTAAAAGAGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172215782 Original CRISPR CCCAGGCCTGAGGGATCCTT TGG (reversed) Intergenic
No off target data available for this crispr