ID: 1172216169

View in Genome Browser
Species Human (GRCh38)
Location 20:33237396-33237418
Sequence TCCACCACATTCCAAAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172216169_1172216175 13 Left 1172216169 20:33237396-33237418 CCTCTTCTTTGGAATGTGGTGGA 0: 1
1: 1
2: 0
3: 10
4: 179
Right 1172216175 20:33237432-33237454 CTTTTTAGGCCCCTGATCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 144
1172216169_1172216173 -1 Left 1172216169 20:33237396-33237418 CCTCTTCTTTGGAATGTGGTGGA 0: 1
1: 1
2: 0
3: 10
4: 179
Right 1172216173 20:33237418-33237440 AGTGGGGCTGTCTCCTTTTTAGG 0: 1
1: 0
2: 2
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172216169 Original CRISPR TCCACCACATTCCAAAGAAG AGG (reversed) Intronic
900197488 1:1384094-1384116 TCCACCACAGGCCAGAAAAGAGG + Intergenic
901874893 1:12161817-12161839 CCCATCTCCTTCCAAAGAAGAGG - Intergenic
902837176 1:19054617-19054639 CCCCCCAGATTCCACAGAAGGGG + Intergenic
902985691 1:20152804-20152826 TCAACCACATTTTACAGAAGGGG - Intergenic
904428173 1:30445073-30445095 TGCAACACATTCCAAAGATTAGG - Intergenic
904956291 1:34286827-34286849 TTCTCCACCTTCCAAAGTAGTGG + Intergenic
909592772 1:77370503-77370525 TCCACCACATTTTAATGAAAGGG + Intronic
910378274 1:86596802-86596824 TCCACCACATCACACAGATGTGG - Intergenic
912267198 1:108170340-108170362 TTCAACACATTTCAAAGAACTGG - Intronic
912529973 1:110313149-110313171 TCTACCACATTCCCATGGAGTGG + Intergenic
913099595 1:115550939-115550961 TCCAACACATTTCAAGGCAGAGG - Intergenic
914854159 1:151338130-151338152 CCCAACACATTTCAAAGAATTGG + Intergenic
916839633 1:168586169-168586191 TCCACCACATACCATACAGGTGG + Intergenic
1063622844 10:7665462-7665484 TTCTCCACATTTCACAGAAGAGG + Intronic
1064729351 10:18313931-18313953 TCTACAACATTTCAATGAAGCGG - Intronic
1065122245 10:22541670-22541692 TCCTCCAAACTCCAAAGAAATGG - Intronic
1068242981 10:54328776-54328798 ATAACCACATTCCAGAGAAGAGG + Intronic
1068657771 10:59592541-59592563 TAAAACACATTCAAAAGAAGGGG + Intergenic
1072634689 10:97170300-97170322 CTCACCACATTTCCAAGAAGTGG - Intronic
1075532877 10:123244817-123244839 TCCACAAGAATCCAAACAAGAGG + Intergenic
1077881241 11:6352254-6352276 TCCACCTCATTCTAAAGATCAGG - Intergenic
1080760465 11:35244156-35244178 TCCACCACATTCTCAAAATGGGG - Intergenic
1082803843 11:57433951-57433973 TCCAGCACTGTCCAAAGGAGAGG - Intergenic
1085603248 11:77874560-77874582 TGCACCAGGTTCCAAAGTAGGGG - Intronic
1088724428 11:112621565-112621587 TCCACCCAATTCCATTGAAGAGG + Intergenic
1088931313 11:114353271-114353293 TCCAATACATTCCAAAGATGGGG - Intergenic
1091088149 11:132743703-132743725 TACACCACATTCCTCAGAACAGG + Intronic
1092308209 12:7323482-7323504 TCTACCACCTGGCAAAGAAGGGG + Exonic
1094678021 12:32640300-32640322 TCCACCACATAGCCCAGAAGTGG - Exonic
1096179467 12:49542691-49542713 GCCACCACCTGCGAAAGAAGAGG - Exonic
1101751332 12:107584974-107584996 TCCTTCACCTTCCAAAGAACAGG - Intronic
1101821899 12:108190815-108190837 TCCACCACATTTAACAGATGGGG + Intronic
1105556846 13:21455302-21455324 TTCTCTACATGCCAAAGAAGAGG + Intronic
1105693599 13:22865849-22865871 ACCACCAACTTCCAAAGAATTGG - Intergenic
1107076852 13:36331074-36331096 TTCACCACAGCCCAATGAAGTGG + Intronic
1107106662 13:36650431-36650453 TTCAGCACATTTCAAAGCAGAGG + Intergenic
1107519434 13:41164328-41164350 ACCACTAAATTCCAAGGAAGCGG - Intergenic
1107612325 13:42128002-42128024 TCCAGCATATTCCAATGGAGTGG + Intronic
1107874879 13:44781726-44781748 TCCTCAAAATTCAAAAGAAGAGG + Intergenic
1108083692 13:46762952-46762974 TCCACCACCTTCCAAAAACAAGG + Intergenic
1108215208 13:48177025-48177047 TCCAGCACCATCCAAACAAGAGG + Intergenic
1109364185 13:61334402-61334424 TCTGCCAAATTCCACAGAAGTGG - Intergenic
1111209269 13:85055460-85055482 ATCACAACATTCCAAAGAAATGG + Intergenic
1111523031 13:89429639-89429661 TCCAACACATTTCAAAGGAAAGG - Intergenic
1115756013 14:36526294-36526316 TTGACCAGAGTCCAAAGAAGGGG - Intergenic
1116215847 14:42016432-42016454 ACCACCATATTCCACAGAAAAGG - Intergenic
1119521472 14:75289089-75289111 TCCACAACAACCCCAAGAAGTGG - Intergenic
1119997395 14:79268562-79268584 TCATCCACATTCCAGAAAAGGGG + Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1122214563 14:100194240-100194262 TCCACCACATTGCCAAGACCAGG + Intergenic
1202903587 14_GL000194v1_random:56332-56354 TCCACCACCTTCCAAGAGAGGGG - Intergenic
1123471164 15:20553480-20553502 CTCAACAAATTCCAAAGAAGCGG + Intergenic
1123646895 15:22447221-22447243 CTCAACAAATTCCAAAGAAGCGG - Intergenic
1123731464 15:23148474-23148496 CTCAACAAATTCCAAAGAAGCGG + Intergenic
1123749602 15:23345886-23345908 CTCAACAAATTCCAAAGAAGCGG + Intergenic
1124281975 15:28369761-28369783 CTCAACAAATTCCAAAGAAGCGG + Intergenic
1124300727 15:28541838-28541860 CTCAACAAATTCCAAAGAAGCGG - Intergenic
1124441349 15:29688331-29688353 TCCTCCAAATTCCAACCAAGAGG + Intergenic
1126330507 15:47526010-47526032 CCCACCACTTACCAAAGAGGAGG - Intronic
1132908541 16:2296852-2296874 TCCCCCACATTCCAACGGGGTGG - Intronic
1133658931 16:7895919-7895941 CCCACACCCTTCCAAAGAAGGGG - Intergenic
1134893868 16:17866315-17866337 TCCACGGCCTTCCAAAGTAGTGG - Intergenic
1135233119 16:20728411-20728433 TCTACCACCTGGCAAAGAAGGGG + Intronic
1136501262 16:30670573-30670595 TGTACCACACACCAAAGAAGGGG + Exonic
1138650232 16:58456281-58456303 CCCTGCACATTCCAAAGAAGGGG + Intergenic
1140055807 16:71524662-71524684 TCTACCACATTCCACAGCACTGG - Intronic
1144306028 17:13970324-13970346 TCCACCCCATGCAAATGAAGTGG - Intergenic
1147566480 17:41539343-41539365 TCCAGCACATTCCACTGGAGGGG - Intergenic
1148488696 17:48009071-48009093 CCCACCACCTTCCAAGGATGAGG - Intergenic
1149016737 17:51916792-51916814 ACTACCTCATTCCAAAGATGAGG - Intronic
1149439751 17:56664284-56664306 TACACCAACTTCCAAAGAGGAGG + Intergenic
1151520903 17:74628897-74628919 TGCACCAGATGCAAAAGAAGAGG + Intergenic
1151851472 17:76692892-76692914 TTCACCAGGTTCCAAAGAACTGG + Intronic
1153496333 18:5703618-5703640 TCCATCACATCCAGAAGAAGAGG - Intergenic
1154999831 18:21675240-21675262 CCCACCTCATTCCACAGATGAGG - Intronic
1155932926 18:31725468-31725490 TCCAGAACACTCCAAAGAGGTGG + Intergenic
1156877164 18:42028710-42028732 TCAACCTCATTTCAAAGATGAGG - Intronic
1158794340 18:60824672-60824694 TACACCTCATTCCCTAGAAGCGG - Intergenic
1161489619 19:4554841-4554863 GCCAACAGATTCCAAAGATGTGG + Intronic
1163849003 19:19653071-19653093 TCCACCACATACCACAGACTGGG + Intronic
1167136271 19:47618042-47618064 TTCACCACAGTCCCAAAAAGGGG - Intronic
927171645 2:20375330-20375352 TCCACCAGATTCCCAGGCAGGGG - Intergenic
927177290 2:20419666-20419688 TCCACCAGATTCCCAGGCAGGGG - Intergenic
927533121 2:23828767-23828789 TCATTCACATTCCAAATAAGGGG + Intronic
928816658 2:35304006-35304028 TTCAACAAATTCCAAACAAGTGG + Intergenic
929060847 2:37923412-37923434 CCCAGCACATTGCACAGAAGAGG - Intronic
936593602 2:113826785-113826807 AACACCACATACCAAAGAAAAGG - Intergenic
937492803 2:122387533-122387555 CCCACCACATTGCAATGAAATGG - Intergenic
937602902 2:123760651-123760673 TCTACCACATCACAAAGAACAGG - Intergenic
939462362 2:142513441-142513463 TCCATCACAGTCCACAGTAGGGG + Intergenic
939468170 2:142584990-142585012 TCCCCCACATGTCAAAGATGGGG + Intergenic
941200244 2:162499361-162499383 TCTACCAAATTCCAATGGAGTGG - Intronic
942307353 2:174621834-174621856 TCCTGCACAGTCCAAAGCAGGGG - Intronic
942959020 2:181807390-181807412 TCCATCCCATTCTAAAGAATGGG - Intergenic
944999687 2:205335249-205335271 CCCACCATGTTCCAAAGATGGGG - Intronic
945140425 2:206680630-206680652 TCCACCACTTTTCTACGAAGGGG + Intronic
946357499 2:219197434-219197456 TATAGCACATTCCAAAGAATGGG - Intronic
948090068 2:235286055-235286077 TCCTCCAGCTTCCAATGAAGAGG + Intergenic
948377958 2:237534461-237534483 AGCACCAAATTCCCAAGAAGCGG - Intronic
1170263530 20:14439963-14439985 CCCTCAACATTCCAAACAAGAGG + Intronic
1172216169 20:33237396-33237418 TCCACCACATTCCAAAGAAGAGG - Intronic
1172216630 20:33240178-33240200 TCCACCACATTCCAAGGAAGAGG - Intronic
1173932442 20:46832118-46832140 TCACCCAGATTCAAAAGAAGGGG + Intergenic
1173997198 20:47347437-47347459 ACCACCACTTTCCAGTGAAGCGG + Intronic
1178173245 21:30066487-30066509 TCCACCATCTTTCAAAGATGAGG - Intergenic
1178743380 21:35224458-35224480 TACATCACATTCGCAAGAAGGGG - Intronic
1179647092 21:42782696-42782718 TCCACCACATCAGAAAGACGAGG + Intergenic
1180977838 22:19860135-19860157 TACACCACATTAGAAAGAAGGGG - Intergenic
1182930947 22:34173889-34173911 TCCACCCCCTTCAAAAGGAGAGG - Intergenic
1183813668 22:40280089-40280111 TCCACCTAATTCCAAAGACATGG + Exonic
1184061388 22:42084316-42084338 TCCAGCAAATTAAAAAGAAGGGG + Intergenic
1184492745 22:44819786-44819808 TTTTCCCCATTCCAAAGAAGAGG + Intronic
951084535 3:18495949-18495971 TGCACCACATTCCAGCAAAGAGG + Intergenic
953304466 3:41814399-41814421 CTCAACAAATTCCAAAGAAGTGG - Intronic
954317960 3:49811534-49811556 TCCACCCTGTTCCACAGAAGAGG + Intronic
954468681 3:50674132-50674154 TCAACCACTTACCAAAGAACAGG - Intergenic
957152323 3:76501374-76501396 TCCTCCACTTTCCACAGTAGAGG - Intronic
958058740 3:88449595-88449617 TGCACCACAATCCAAATAACAGG - Intergenic
959600763 3:108182239-108182261 TCCCCCTCATTCCAAAGCAGTGG - Intronic
965766868 3:172139966-172139988 TCCACCAAATACTAAAGAAATGG - Intronic
966589695 3:181668330-181668352 TCCACCACTTTTTAAAAAAGTGG - Intergenic
968441660 4:627532-627554 TCCACCTCCCTCCTAAGAAGTGG + Intronic
968636829 4:1685022-1685044 TCCAGCAAATTCCCAGGAAGGGG + Intergenic
968866139 4:3213196-3213218 TCCACCTCACACCAAAGAAAGGG + Intronic
971089332 4:23322202-23322224 TCCACCATATTCCTTATAAGTGG + Intergenic
972818627 4:42673493-42673515 TCCAACTGATTCCAAAGAAAAGG - Intergenic
973148596 4:46860549-46860571 TTCACCAGATGTCAAAGAAGGGG - Intronic
973294656 4:48503976-48503998 TCCATTACATCCCAAAGTAGAGG - Intronic
973311832 4:48717788-48717810 TCCCTCACATTCCAAAGTACTGG + Intronic
976184602 4:82431027-82431049 TCCTCCCCATTCCACACAAGAGG - Intronic
977059990 4:92246037-92246059 TACACCAGATTTCAAAGAATTGG + Intergenic
978107081 4:104916306-104916328 GCCACAACAATACAAAGAAGGGG + Intergenic
978697556 4:111600464-111600486 TCCAACACATCCCAAAGAAAGGG - Intergenic
979956721 4:126962242-126962264 ACCACCACACTCAAAAGATGGGG - Intergenic
982406411 4:155024981-155025003 TCCTTCACAATACAAAGAAGAGG - Intergenic
982893538 4:160886722-160886744 TCAATGACATGCCAAAGAAGAGG + Intergenic
989774435 5:45186193-45186215 TACACCACTTTCTAAATAAGAGG + Intergenic
991134221 5:63162620-63162642 TCCTCCAAATTCAAATGAAGTGG + Intergenic
993315735 5:86403702-86403724 TCCACCCCCTACCAAATAAGAGG - Intergenic
996403154 5:123084766-123084788 TCTTCAACAGTCCAAAGAAGAGG - Intergenic
998378091 5:141704472-141704494 TCCACAACAATCCAATGAAATGG - Intergenic
1001278435 5:170367802-170367824 TCCACACCATTCCAAAGAGATGG + Intronic
1005524659 6:26634152-26634174 TGCACCACATTCCATAAATGGGG - Intergenic
1005712274 6:28513547-28513569 TTCACCACAATATAAAGAAGTGG - Intronic
1007172960 6:39877414-39877436 TTCACCACCATCCAAGGAAGGGG - Intronic
1008393229 6:50977469-50977491 TCAACCACATACTTAAGAAGAGG - Intergenic
1010011160 6:71050096-71050118 TCCACAAGATTCCACAAAAGAGG + Intergenic
1011712322 6:90067265-90067287 TCCACCACACTCCACAAGAGGGG - Intronic
1012136933 6:95569596-95569618 TCTACAACATTCCAAACAGGTGG - Intergenic
1013025050 6:106263246-106263268 TTCACCACAGTCCAACAAAGTGG + Intronic
1014179770 6:118372036-118372058 TCTAAGACATTCCAAAAAAGTGG + Intergenic
1018388389 6:163325043-163325065 ACCACCACATCTCACAGAAGAGG + Intergenic
1024270095 7:47635616-47635638 TCGACCACCTTCCACAGAGGGGG - Intergenic
1024330682 7:48151803-48151825 TCCACCTCTTTCCATAGAACTGG - Intergenic
1024524419 7:50336373-50336395 TCCACCCCTTCCTAAAGAAGGGG - Intronic
1024529357 7:50378373-50378395 TCCACCTCATTACAAAGGCGAGG - Intronic
1027974564 7:85134753-85134775 TCCATCATATGTCAAAGAAGTGG - Intronic
1030061782 7:105627779-105627801 TCCTCCACCTTCCAAAGTGGTGG + Intronic
1031845107 7:126796406-126796428 AACACCACATTTTAAAGAAGTGG - Intronic
1033920694 7:146387784-146387806 TCCACCAGCTTCCTAAGAAAGGG + Intronic
1036815847 8:11902451-11902473 GCCACCTCATTCCAAGGAAGCGG + Intergenic
1038177768 8:25196832-25196854 TACAACTCATTCCAAAGAACTGG - Intronic
1039008048 8:33062887-33062909 TCCACAACATTCCAATCAAAAGG + Intergenic
1039176528 8:34813762-34813784 CCCACTTCATTCCTAAGAAGTGG - Intergenic
1039187662 8:34935042-34935064 TCCAAGACATCCCAAACAAGTGG + Intergenic
1039870906 8:41544311-41544333 TCCCCCACAGTCCTGAGAAGCGG + Exonic
1041095169 8:54342585-54342607 TCCCCCACACTCCCAAGAAGGGG - Intergenic
1041696237 8:60739723-60739745 TCTAACACATTCCTAACAAGGGG - Intronic
1041801156 8:61801604-61801626 TCCACCATCCTCCACAGAAGTGG + Intergenic
1042404806 8:68391925-68391947 TCCACCACATGCCCAGAAAGAGG + Intronic
1042538781 8:69886461-69886483 TTTACCACATAGCAAAGAAGTGG + Intergenic
1042867900 8:73371667-73371689 TCCACCTAATTCCTAAGAAATGG + Intergenic
1043390280 8:79785092-79785114 TCCACCACTTTCCAAAAGAAAGG - Intergenic
1043582570 8:81731500-81731522 TCAAGCACACTACAAAGAAGTGG - Intronic
1045890784 8:107154601-107154623 TTCAATACATTCCAAAGAAGGGG + Intergenic
1051949095 9:22609105-22609127 TTCACCAGATTCCAAAGTAGAGG + Intergenic
1053108699 9:35438098-35438120 GTCACCACATCCCAAGGAAGGGG + Intergenic
1053173661 9:35907729-35907751 TCCACCCCATTGCAGAGAAGAGG - Intergenic
1057822657 9:98344433-98344455 TCCATCAGACTCTAAAGAAGAGG + Intronic
1060205888 9:121682649-121682671 TCCCCCACATTTCACAAAAGGGG - Intronic
1060921570 9:127424133-127424155 TCCACCAGAATCCAACGAAATGG - Intergenic
1061414343 9:130438275-130438297 GCCTCCACTTTCCAAGGAAGGGG + Intergenic
1203563966 Un_KI270744v1:77953-77975 TCCACCACCTTCCAAGAGAGGGG + Intergenic
1186556437 X:10564979-10565001 TCCACCACCAACCAAAAAAGGGG + Intronic
1191867601 X:65717733-65717755 TCCACCAGACTCCGATGAAGTGG + Intronic
1194752944 X:97704925-97704947 TTCTCCTCATGCCAAAGAAGCGG - Intergenic
1197147990 X:123190063-123190085 CCCACCAAATTGCAAAGAATGGG - Intronic
1197890737 X:131267966-131267988 TCTACAACATACCAAACAAGCGG - Intergenic
1199589721 X:149455974-149455996 GTCACCACATTCTAGAGAAGTGG - Intergenic
1199589728 X:149456030-149456052 GTCACCACATTCTAGAGAAGTGG - Intergenic
1201159467 Y:11156541-11156563 TCCACCACCTTCCAAGAGAGGGG - Intergenic