ID: 1172216388

View in Genome Browser
Species Human (GRCh38)
Location 20:33238602-33238624
Sequence CAAAATGACCACAGTGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172216388_1172216391 14 Left 1172216388 20:33238602-33238624 CCCACTACACTGTGGTCATTTTG 0: 1
1: 0
2: 0
3: 18
4: 169
Right 1172216391 20:33238639-33238661 GAAATCCCTTAGAACACAGACGG 0: 1
1: 0
2: 0
3: 15
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172216388 Original CRISPR CAAAATGACCACAGTGTAGT GGG (reversed) Intronic
902742465 1:18448484-18448506 CCACAGGCCCACAGTGTAGTGGG + Intergenic
904179737 1:28657731-28657753 TAAATTGTCCATAGTGTAGTGGG + Intergenic
904919830 1:33998437-33998459 CAAAATGACCAGTCTGTAGTAGG + Intronic
907834578 1:58096993-58097015 CAGAAAGACCACACTGAAGTGGG + Intronic
908856030 1:68430192-68430214 GACAATGACTACAGCGTAGTAGG + Intronic
909053029 1:70790383-70790405 CAAAATGCCCACAGGGTACAAGG - Intergenic
909464334 1:75956504-75956526 CAAATTGCCCAAAATGTAGTAGG + Intergenic
910056195 1:83035528-83035550 CAAAGCGTCCACAGTGTGGTAGG + Intergenic
910411843 1:86954484-86954506 CAATATGAACACATTGTAATAGG + Intronic
910727870 1:90357778-90357800 AAAAATGAAAACATTGTAGTAGG - Intergenic
912317311 1:108677861-108677883 CACAATGTACACAGAGTAGTTGG - Intergenic
912593901 1:110854675-110854697 CACTATGACCACAGTGAGGTGGG - Intergenic
913695529 1:121321557-121321579 CAAAATTACCTCAGTGTGGATGG - Intronic
914142036 1:144958503-144958525 CAAAATTACCTCAGTGTGGATGG + Intronic
915853320 1:159351818-159351840 GATAATGACCACAGTGAGGTGGG - Intergenic
915860616 1:159440516-159440538 GACAATGACCACAGTGAGGTGGG - Exonic
918516838 1:185372671-185372693 CAGAAAGACCACAAAGTAGTTGG - Intergenic
920482857 1:206339940-206339962 CAAAATTACCTCAGTGTGGATGG - Intronic
920771230 1:208888053-208888075 CAAAAAGTACACAATGTAGTAGG + Intergenic
920904291 1:210146455-210146477 CAAAATGTAAACAGTGTATTAGG + Intronic
923231051 1:231986765-231986787 TAATGTGACCACAGTGCAGTGGG + Intronic
923926935 1:238639943-238639965 CATAAACACCACAGTCTAGTTGG + Intergenic
924926091 1:248682367-248682389 AAAAGTGAACACAGTGTGGTAGG + Intergenic
1064589234 10:16871630-16871652 TAAAATGAATACAGTGTTGTTGG - Intronic
1066761777 10:38761598-38761620 CAAAATAATCACAGTGCATTTGG - Intergenic
1068430205 10:56921730-56921752 TAAAATCATCACATTGTAGTTGG - Intergenic
1071465423 10:85935377-85935399 CAAAATCACCCCAGTGTGGCTGG + Intronic
1071521413 10:86333405-86333427 CAAAATGTTCCCAGTCTAGTGGG - Intronic
1071764296 10:88644821-88644843 CAAAAAGACTAAAGTGTAGAAGG - Intergenic
1071992898 10:91117128-91117150 GAAAATGTATACAGTGTAGTAGG + Intergenic
1073573785 10:104603608-104603630 CAATATGACCACTGTGTAGCTGG - Intergenic
1074539010 10:114349568-114349590 AAAAAAGAACACAGTGTAGAAGG + Intronic
1076525330 10:131109049-131109071 CAGGATGAGCACAGTGTTGTGGG + Intronic
1082616613 11:55368692-55368714 TAAAATGACCACAGTGACGTGGG - Exonic
1082630598 11:55537719-55537741 CAAGATGACCACTGTGTGGTGGG - Intergenic
1082633869 11:55572846-55572868 CAAGATGACCACAATGATGTGGG - Exonic
1086629967 11:89005843-89005865 CAAAATGACAACAATATGGTAGG - Intronic
1087670832 11:101104882-101104904 CAACTTGACAACACTGTAGTGGG + Intronic
1088739582 11:112756253-112756275 TAAAATGACCACCATGAAGTAGG + Intergenic
1089795622 11:120978203-120978225 CAAAGAGCTCACAGTGTAGTGGG + Intronic
1090469038 11:126962760-126962782 AAATAAGACCACAGTGAAGTTGG - Intronic
1091532222 12:1370208-1370230 CAAAATAATCACAATGGAGTTGG - Intronic
1093126241 12:15331543-15331565 GAAAATGACCACAAAGTACTGGG + Intronic
1093426790 12:19036894-19036916 CAAAATGAACACTGTGTTGGTGG - Intergenic
1095260151 12:40088706-40088728 CAAAAACACCAAAGTGTGGTAGG + Intronic
1100818488 12:98408634-98408656 CATAAAGACTACAGTCTAGTGGG + Intergenic
1100902469 12:99258103-99258125 CAAAAAAACCACAGTTTATTAGG + Intronic
1105782808 13:23719277-23719299 CAATTTGCCCACAGTTTAGTGGG + Intergenic
1106280795 13:28267818-28267840 CATAATTCCCACAGTGTTGTGGG - Intronic
1106483169 13:30151802-30151824 CAAAATGAACACTGTGTATGTGG + Intergenic
1106540368 13:30684876-30684898 CCAAATGATCACATTGTAGATGG + Intergenic
1107246303 13:38300406-38300428 CAAGAAGAACACAATGTAGTTGG + Intergenic
1107727597 13:43315580-43315602 CAAAATTAACACAGTGTTGTTGG - Intronic
1109024907 13:57144341-57144363 CACAATGAGCACTGTGCAGTGGG + Intronic
1109025894 13:57150911-57150933 CACAATGAGCACTGTGCAGTGGG + Intronic
1109026884 13:57157484-57157506 CACAATGAGCACTGTGCAGTGGG + Intergenic
1109027876 13:57164055-57164077 CACAATGAGCACTGTGCAGTGGG + Intergenic
1109028862 13:57170620-57170642 CACAATGAGCACTGTGCAGTGGG + Intergenic
1110928322 13:81183669-81183691 CAAAATGACCATAAGGAAGTAGG - Intergenic
1114429223 14:22645981-22646003 CATATTGATCACAGTGTATTAGG - Intergenic
1114729490 14:24976533-24976555 CAAAATGACAACAGTGGAGGGGG + Intronic
1115008307 14:28512748-28512770 CTAAATTAGCACAGTGCAGTAGG + Intergenic
1116460699 14:45169884-45169906 CAAAATGAGTAAAGTGTAGGGGG - Intronic
1119394136 14:74313483-74313505 CAAAATGTCTGCAGTGTAGCTGG + Intronic
1120877020 14:89384293-89384315 CAAAGTGAGCACAGTGAAGCAGG - Intronic
1126102250 15:45125915-45125937 GAAAATGTCCACAGGGTGGTTGG - Intronic
1127345722 15:58095839-58095861 CAAAATGAATACAGAGTAATTGG - Intronic
1130840250 15:87693309-87693331 CAAAGTGCCAACAGTGGAGTGGG - Intergenic
1131875218 15:96798724-96798746 CAAACAGACCACAGTGTAGGAGG - Intergenic
1136998825 16:35210635-35210657 CAAAATGACCATAGTGCATATGG - Intergenic
1137858437 16:51820494-51820516 CATAATGACCTCAGTGTTGCAGG + Intergenic
1138233612 16:55360281-55360303 CAAAGTGTCTACAGTCTAGTGGG - Intergenic
1141525975 16:84612186-84612208 CCTAATGACCACACTGTAGCAGG + Intronic
1143360911 17:6370457-6370479 AAAAAAGAACACATTGTAGTGGG - Intergenic
1149586151 17:57788440-57788462 CAACATGACCACAGACTAGTAGG + Intergenic
1153431164 18:5018904-5018926 CAAAACAACCACAGTGTGGAAGG + Intergenic
1154942826 18:21131941-21131963 CAAAGCTACCACAGTGTAGAAGG + Intergenic
1156697897 18:39789665-39789687 CAAGATGACCACTGTCTATTTGG + Intergenic
1159821533 18:73152403-73152425 CAAAAAGCTCAAAGTGTAGTTGG + Intronic
1164968663 19:32510607-32510629 CAAAAGGACCCCAGTGTAACAGG + Intergenic
1165963293 19:39553215-39553237 CACAATGACCAAAGTGCACTCGG - Intergenic
1165979445 19:39707247-39707269 CAGGATGACCAAAGTGCAGTCGG - Exonic
927062705 2:19439536-19439558 CAAGATGACCACAGTGATCTAGG - Intergenic
928060493 2:28107763-28107785 CAAAATCTTCACAGTCTAGTGGG - Intronic
936699581 2:114994818-114994840 CTAAATAACCACTGTGTAGTTGG - Intronic
937091616 2:119210051-119210073 CACAGTGACCACAATGTACTTGG + Intergenic
938706574 2:133935284-133935306 CAAATTTCCCACAGTGTAGAGGG + Intergenic
940224960 2:151391515-151391537 CAAAATGACCACAATGTTCTTGG + Intergenic
944293067 2:198030115-198030137 AAAAATAACTACTGTGTAGTAGG - Intronic
945817773 2:214626697-214626719 TAAAATGAATAAAGTGTAGTGGG + Intergenic
946655535 2:221941912-221941934 CCAAATGACCACAGTCTACCTGG + Intergenic
948081104 2:235206141-235206163 CCAAATGCCCACTGTGCAGTGGG - Intergenic
1168775023 20:440185-440207 GAAAATGACCACAGTGGGATGGG + Intronic
1170790806 20:19508017-19508039 GAAAATGCCTACAGTGTGGTTGG + Intronic
1171279752 20:23885956-23885978 CAAAATGTCCACAGTGGGGAGGG + Intergenic
1172216388 20:33238602-33238624 CAAAATGACCACAGTGTAGTGGG - Intronic
1173079683 20:39853655-39853677 CAAAATGACCAGGGAGGAGTTGG - Intergenic
1174077412 20:47947807-47947829 CAAAATGGCAACAGTGGAGATGG - Intergenic
1178782988 21:35623870-35623892 CAGGATGACCACAGTGGAGGGGG - Intronic
1180793793 22:18592099-18592121 CAAAAGCACCACAGGGTGGTGGG - Intergenic
1181227947 22:21403221-21403243 CAAAAGCACCACAGGGTGGTGGG + Intergenic
1181250706 22:21531618-21531640 CAAAAGCACCACAGGGTGGTGGG - Intergenic
949797891 3:7870667-7870689 CAAAATTACCACAGAGAATTAGG - Intergenic
950784272 3:15420740-15420762 CAAAATGTACTCAGTGTATTAGG - Intronic
952438672 3:33299962-33299984 CACATTGACTACAGTGTAGATGG + Intronic
952673030 3:35993990-35994012 CAGCTTGACCACAGTGGAGTAGG + Intergenic
955889051 3:63631327-63631349 TAAAATGACCTCTGTGTTGTTGG - Intergenic
957428947 3:80076653-80076675 GAAAAGGACCAAAGTGCAGTTGG - Intergenic
958133062 3:89454422-89454444 CCAGATGATCACAGTGTAGAGGG - Intronic
962668945 3:137685448-137685470 CAAGTTGGTCACAGTGTAGTGGG - Intergenic
962915351 3:139897094-139897116 CAAAATGATCATAGTGTGGGGGG - Intergenic
964027770 3:152098676-152098698 AAAAATAACCACAGTGTTATGGG - Intergenic
969014372 4:4093858-4093880 CACAGTGACCACAGTCTAGAAGG + Intergenic
970010424 4:11452865-11452887 TAAAATGACTACTGTGTACTAGG - Intergenic
971781268 4:31037450-31037472 AAGTATGAACACAGTGTAGTGGG - Intronic
973308911 4:48685676-48685698 GAAAATGACCACAGGGAATTGGG + Intronic
977181230 4:93877719-93877741 AAAAATGACCAGAATGTAGTAGG + Intergenic
977656732 4:99530915-99530937 CAAAGTGGCCAGAGTGTAGCAGG - Intronic
978433893 4:108662470-108662492 TAAAATGACCTCAGTGGAGAAGG - Intronic
979067056 4:116150813-116150835 CGAAATGACGACTGTGCAGTAGG - Intergenic
980834648 4:138176031-138176053 CAAAATGATCATAGAGTAGTTGG + Intronic
981209726 4:142088832-142088854 CAAAATTTCCACAGTCTAGTAGG + Intronic
981615746 4:146641628-146641650 CAAAAGGAACACAGTATAGGAGG - Exonic
983300066 4:165913861-165913883 AAAAATGACCAGAGTGTGGGTGG + Intronic
984364006 4:178774679-178774701 AAAAATTAACACAGTTTAGTAGG + Intergenic
985443614 4:190005134-190005156 CTAATTCACCACAGTGAAGTAGG + Intergenic
987883140 5:23775703-23775725 TAAAAAGACAAAAGTGTAGTGGG - Intergenic
994944338 5:106366462-106366484 CAAAATGATCAGAGTGAAGAGGG + Intergenic
995825900 5:116298751-116298773 CAAAATAACCACACTGAAGGAGG - Intronic
995932505 5:117464900-117464922 CAAAATAACTACAGTGGATTTGG - Intergenic
995999110 5:118336924-118336946 CAAAATGACCACACTGTCCAAGG + Intergenic
997923259 5:138003229-138003251 TAAATTGACCACAGTCTAGAAGG + Intronic
998633054 5:143922107-143922129 CAGAATGAACACTGTGAAGTAGG - Intergenic
1003983020 6:11407213-11407235 CAAAAAGAACAGAGAGTAGTTGG + Intergenic
1004753242 6:18584877-18584899 CAAAATGCCCACAGTTTAGGGGG - Intergenic
1005017851 6:21390957-21390979 CAAAATAACACCAGTGGAGTAGG - Intergenic
1005800968 6:29424275-29424297 GGAAATGATCACAATGTAGTGGG - Intronic
1006901490 6:37505181-37505203 CAAAATGCACACAATATAGTGGG - Intergenic
1007977711 6:46118511-46118533 CAAAAAGTTTACAGTGTAGTAGG - Intergenic
1008340769 6:50361479-50361501 CAAAATGGCCACAGTGCTTTAGG - Intergenic
1013120896 6:107139576-107139598 CAAGAAGCCCACAGTATAGTGGG + Intergenic
1013243519 6:108267564-108267586 GAACATGACCCCAGTGTGGTTGG + Intergenic
1015469212 6:133584640-133584662 CATAATGCCCACAATGCAGTTGG - Intergenic
1016267033 6:142244787-142244809 GAACATGACCAGAGTTTAGTGGG + Intergenic
1016750512 6:147626176-147626198 CAAAAGGATCACAGTGTCATTGG + Intronic
1016827019 6:148397884-148397906 CAAAGAGGCCACAGTTTAGTAGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017519698 6:155191106-155191128 CAAAATGCCAGCAGTGTAGAAGG + Intronic
1017622092 6:156309456-156309478 CACAATGTCCACAGTCCAGTAGG - Intergenic
1022620564 7:31979811-31979833 CAAAATAACCACACAGTACTTGG - Intronic
1022750583 7:33219825-33219847 CAAAATTTCCACAGTGTGGAAGG - Intronic
1024295287 7:47836860-47836882 AAAAGGGGCCACAGTGTAGTCGG + Intronic
1025160945 7:56660235-56660257 CAAAATCTCAACAGTGTACTGGG - Intergenic
1025874790 7:65470614-65470636 CAAGACGATCACAGTCTAGTAGG - Intergenic
1025921717 7:65919624-65919646 CAAGATGACCGCAGTGGAGGTGG - Intronic
1026106122 7:67422167-67422189 AAAAATGGCAACAGTGGAGTGGG + Intergenic
1030395540 7:108981628-108981650 CATAATGAACACAATGTGGTGGG - Intergenic
1033463591 7:141569804-141569826 CAAAATGGCCACTGTGTCTTAGG + Intronic
1035255635 7:157624701-157624723 CAGGATGACCACAGTATAGACGG - Intronic
1035767395 8:2118156-2118178 CGAAAAGATTACAGTGTAGTGGG + Intronic
1036384051 8:8262447-8262469 CATATTGACCTCAGAGTAGTTGG + Intergenic
1038436879 8:27542530-27542552 GAAAATGACCAAACTGCAGTTGG + Intronic
1039540795 8:38367131-38367153 CAAAATGTCCACAGAGTAGAAGG + Intronic
1041173638 8:55170979-55171001 CAAAAATACCACAGGGGAGTTGG - Intronic
1043320294 8:78976108-78976130 CAAAATGACCACTCTGGTGTAGG - Intergenic
1045407249 8:101879547-101879569 CAAAACCACCACTGTGTGGTGGG + Intronic
1045837997 8:106546297-106546319 CAAAGTGAGCACAGTTTAGCAGG - Intronic
1045970372 8:108073209-108073231 CAAGATGACCACAGTGTCCATGG + Intronic
1047826233 8:128579352-128579374 CAAAAAGGCCACAGTGTCTTTGG + Intergenic
1047851631 8:128863570-128863592 GCAAATGACCAGAGTGGAGTCGG - Intergenic
1048525209 8:135196277-135196299 CACCATGACCACATTGTAATTGG - Intergenic
1051413098 9:16811246-16811268 CAAAAAAACCACAGTGTATAGGG + Intronic
1054963138 9:70992172-70992194 CAAAAGGACCACAATGTGCTGGG - Intronic
1055598246 9:77887570-77887592 CAAAATGCCCACAGTTTATCTGG - Intronic
1055938766 9:81628503-81628525 CAAAATGACAACATTATAGAAGG - Intronic
1059088196 9:111327687-111327709 CAAAATCACCACAGTCAAATGGG + Exonic
1059774134 9:117458040-117458062 CAAAATGACCTCACTGAAGAGGG + Intergenic
1060050219 9:120373347-120373369 CAAAAAGACCACAGTCTTTTTGG - Intergenic
1188099577 X:26067538-26067560 CAAAATGATTTCACTGTAGTAGG - Intergenic
1189122774 X:38412879-38412901 CAAAAGAACCACAGTGTCATTGG - Intronic
1189205219 X:39232353-39232375 CAAAATGTCTTCAGTCTAGTGGG - Intergenic
1191045186 X:56128816-56128838 CAAAAAACCCACAGTGTAGTTGG + Intergenic
1191934536 X:66412147-66412169 CAGAATGTCCACAGTTTAGGTGG - Intergenic
1195476132 X:105287918-105287940 CAAGAAGCCCACAGTCTAGTAGG + Intronic
1197276431 X:124484867-124484889 CAAAGAGCTCACAGTGTAGTTGG - Intronic
1198157758 X:133978819-133978841 CAAGATGATCACAGTCTAGTAGG + Intronic
1198619711 X:138492567-138492589 CACAGTGACCACACTGTGGTAGG + Intergenic
1201252397 Y:12072585-12072607 CCAAATGACCTCTGTGTAGTTGG - Intergenic