ID: 1172221281

View in Genome Browser
Species Human (GRCh38)
Location 20:33276726-33276748
Sequence CAGGGACAGCCTGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 970
Summary {0: 1, 1: 0, 2: 11, 3: 70, 4: 888}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172221269_1172221281 30 Left 1172221269 20:33276673-33276695 CCCAAGAGATTGGCAGAGAGAGG 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1172221281 20:33276726-33276748 CAGGGACAGCCTGAGGAGGAGGG 0: 1
1: 0
2: 11
3: 70
4: 888
1172221271_1172221281 29 Left 1172221271 20:33276674-33276696 CCAAGAGATTGGCAGAGAGAGGA 0: 1
1: 1
2: 2
3: 29
4: 359
Right 1172221281 20:33276726-33276748 CAGGGACAGCCTGAGGAGGAGGG 0: 1
1: 0
2: 11
3: 70
4: 888

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172221281 Original CRISPR CAGGGACAGCCTGAGGAGGA GGG Intronic
900400319 1:2470362-2470384 CAGGGCCAGCTTGAGCAGGGAGG + Intronic
900464686 1:2819957-2819979 CAAGGTCAGACTCAGGAGGAGGG - Intergenic
900530182 1:3149212-3149234 CAGGGGCAGCCACTGGAGGATGG + Intronic
900840695 1:5046512-5046534 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
900847373 1:5114783-5114805 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
900865574 1:5266479-5266501 CAGGCACAGCTTGGGGAGCAGGG - Intergenic
901229666 1:7634683-7634705 CTGGGGCTGCCGGAGGAGGAAGG + Intronic
901400148 1:9010235-9010257 CAAGGACAGCCTGGAGGGGAAGG + Exonic
901436338 1:9249399-9249421 CCGGGACAGTCTGAGGATGTTGG + Intronic
901527255 1:9831380-9831402 GAGGGAAAGCCTGAGGCAGAAGG + Intergenic
901744547 1:11363795-11363817 CAGGGACTTCCTGAGAAGGGCGG + Intergenic
901838570 1:11939475-11939497 CTGGGACTGCTTGGGGAGGAGGG + Intronic
901848859 1:12002260-12002282 CATAGACAGCCTGGTGAGGAGGG + Intronic
902052790 1:13577363-13577385 CAGGGACAGTCTGGGAAGGCAGG - Intergenic
902156346 1:14490039-14490061 CACCAACAGCCTGAAGAGGAAGG + Intergenic
902353814 1:15880916-15880938 AAGGAACAACCTGAGGTGGAAGG + Intronic
902375194 1:16027170-16027192 CAGGGACAGACAGAAGGGGAGGG - Intronic
902834221 1:19036313-19036335 CAGAGAGAGCCTGAGCAGGGAGG + Intergenic
903375310 1:22862109-22862131 CAGGGCCAGCAAGAAGAGGAAGG + Intronic
903460005 1:23514258-23514280 GAGGCACAGCAGGAGGAGGATGG + Intronic
903888226 1:26553553-26553575 CAGGGCCATCCTGAGGTGGGTGG + Intronic
903970916 1:27118254-27118276 CCGGGCCAGGCTGAGGAGAAAGG + Intronic
904393862 1:30205048-30205070 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
904494862 1:30880786-30880808 CACAGAATGCCTGAGGAGGAGGG + Intronic
904663310 1:32101200-32101222 CAGGGTAAGGCTGAGTAGGAAGG - Intronic
905239971 1:36575196-36575218 CAAGGACAGCCAGGGGTGGAAGG + Intergenic
905429180 1:37909308-37909330 AAGGAGCAGCCTGGGGAGGAGGG - Intronic
905471652 1:38196658-38196680 CAGGGACAGCCTGCTGAGGGAGG + Intergenic
905914419 1:41675047-41675069 CAGGGACACCCATGGGAGGATGG - Intronic
905995868 1:42380506-42380528 GTGGGACAGCCGGAGCAGGAGGG - Intergenic
906169971 1:43716733-43716755 TAGGGACTGCATGAGGAGGCCGG + Intronic
906237241 1:44219393-44219415 CAGGAACAGCCTGGGGGAGAAGG - Exonic
906238361 1:44225807-44225829 TAGGGAGACCCTCAGGAGGAAGG + Intronic
906706090 1:47896054-47896076 CAGGGACAGCCTGTGGTTTAGGG - Intronic
906747855 1:48234168-48234190 CAGACACAGCCGGAGGAGCATGG + Intronic
907251983 1:53145737-53145759 TAGGGATAGCCTGAGGAGCAAGG + Intergenic
907311336 1:53540726-53540748 CAGGGACCGCCTGCCCAGGATGG + Intronic
907394309 1:54178599-54178621 GAGGGACAGGCTGAGGTGGGAGG + Intronic
907503655 1:54901914-54901936 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
909223737 1:72991818-72991840 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
909535266 1:76728633-76728655 GAGGGAGATGCTGAGGAGGAGGG - Intergenic
909776785 1:79492609-79492631 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
909909871 1:81247103-81247125 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
909978538 1:82071545-82071567 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
910002835 1:82358938-82358960 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
910102991 1:83598506-83598528 CAAGGATAGCCTCAAGAGGATGG - Intergenic
910473548 1:87580905-87580927 CAGTGACTGCCTGTGTAGGATGG - Intergenic
911070977 1:93831690-93831712 AAGGAGCAGCCTGGGGAGGAGGG - Intronic
911148140 1:94571252-94571274 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
911149091 1:94580026-94580048 GATGGAATGCCTGAGGAGGAAGG - Intergenic
911570316 1:99511301-99511323 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
911862472 1:102970253-102970275 CAGGGACCACCTGGGAAGGATGG - Exonic
911983759 1:104597627-104597649 GAGGAACAGTCTGGGGAGGAGGG - Intergenic
912285582 1:108365113-108365135 GAAGGACAGAATGAGGAGGAAGG - Intergenic
912449520 1:109760586-109760608 CAGGCAGAGCAAGAGGAGGATGG - Intronic
912813467 1:112811065-112811087 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
912815410 1:112824577-112824599 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
913167661 1:116203457-116203479 CTTTGACAGCCTGGGGAGGATGG - Intergenic
913600782 1:120419926-120419948 CCAGGACACCCTCAGGAGGACGG - Intergenic
914086275 1:144456707-144456729 CCAGGACACCCTCAGGAGGACGG + Exonic
914192169 1:145420658-145420680 CCAGGACACCCTCAGGAGGACGG + Intergenic
914244643 1:145876621-145876643 GAGGCACAGCCAGAGGAGGCTGG + Exonic
914590076 1:149098608-149098630 CCAGGACACCCTCAGGAGGACGG + Exonic
914681163 1:149939186-149939208 GAGGGGCAGCCGGAGGAGGGAGG + Exonic
914681766 1:149943898-149943920 CAGGGAAGAACTGAGGAGGAGGG - Exonic
914971227 1:152309414-152309436 CAGGGTCAAGCAGAGGAGGAAGG - Exonic
915460634 1:156068594-156068616 CTGGGAAATCCTGAGGAAGAGGG - Intronic
915551903 1:156640322-156640344 CTGGGACAGTCTGGGGAGGAAGG - Intergenic
915603154 1:156935175-156935197 CAGGGACAGGGTGGGGAAGAGGG + Exonic
915625090 1:157109550-157109572 CAGGGCCTTCCTGAAGAGGAGGG - Intergenic
916059811 1:161090522-161090544 CTGGGATAGCCAGAGGAAGAGGG + Intergenic
916257497 1:162804617-162804639 GAGGGACAGGCAGAGCAGGACGG + Intronic
916328771 1:163592678-163592700 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
917791922 1:178504463-178504485 CTGGAACTGCCTGAGAAGGAAGG + Intergenic
918078062 1:181185476-181185498 GAGAGACAGCCTGGTGAGGAAGG + Intergenic
918347024 1:183615312-183615334 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
918457003 1:184731587-184731609 GAGGGAGGGCATGAGGAGGAAGG - Intronic
918567765 1:185952346-185952368 GAGGAGCAGCCTGGGGAGGAAGG + Intronic
919143232 1:193600458-193600480 CATGTCCAGACTGAGGAGGAAGG - Intergenic
919476310 1:198036457-198036479 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
919742794 1:200990837-200990859 CAGGGCCAGGGTGAGGAAGAGGG - Intronic
920192678 1:204203518-204203540 CAGGGCAATTCTGAGGAGGAAGG - Intronic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
920565133 1:206967059-206967081 CAGGCACAGTATGAGGAAGAGGG + Exonic
920901625 1:210114868-210114890 AAGGAGCAGCCTGGGGAGGAGGG + Intronic
920982873 1:210854677-210854699 CAGGGACCACCTGAGGAGAAGGG + Intronic
921039581 1:211416798-211416820 CAGGCTGAGCCTGAGCAGGACGG - Intergenic
921212328 1:212911169-212911191 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
921459872 1:215413989-215414011 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
921520041 1:216147211-216147233 GAGGAACAACCTGGGGAGGAAGG - Intronic
921670294 1:217917454-217917476 CAGGGCCTGTCTGAGCAGGAGGG - Intergenic
921733061 1:218597838-218597860 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
922049626 1:221977152-221977174 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
922131832 1:222787604-222787626 CAAGGGCGTCCTGAGGAGGACGG - Intergenic
922154160 1:223028450-223028472 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
922363645 1:224844543-224844565 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
922614458 1:226953478-226953500 CAGGCAGGGCCTGAGGAGAAGGG + Intronic
922764711 1:228150843-228150865 CAGGGACAGCCTTAGGAGGCTGG + Intronic
923257363 1:232233249-232233271 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
923460588 1:234206358-234206380 GAGGGACAGTGTGAGGAGCAGGG + Intronic
923962697 1:239103005-239103027 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
924138178 1:240993047-240993069 GAGGGAGAGCGAGAGGAGGAAGG + Intronic
1062843192 10:686727-686749 CAGGGACAGGCAGTGGAAGAAGG + Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1062978604 10:1703277-1703299 CAGGGAACACCTGATGAGGAGGG + Intronic
1063115011 10:3067161-3067183 CAGGGGCAGCGTCCGGAGGAGGG - Intronic
1063194719 10:3730453-3730475 CCAGCACAGCCTGATGAGGATGG - Intergenic
1063509691 10:6633641-6633663 AAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1063527770 10:6801138-6801160 AAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1064148686 10:12844880-12844902 GAGGGACAGCTTGAGGAGCAGGG - Intergenic
1064745563 10:18475094-18475116 CAGGAACAGCCAGAGGAGAGAGG + Intronic
1064887085 10:20123209-20123231 GAGGAGCAGCCTGGGGAGGAGGG + Intronic
1064909036 10:20379887-20379909 CAGAGACAGACTGAGGATGTTGG - Intergenic
1065140381 10:22714102-22714124 CAGCTGCAGCCGGAGGAGGAGGG + Intronic
1065791582 10:29265270-29265292 AAGGAACAGCCTAAGGAAGAGGG - Intergenic
1065889488 10:30109078-30109100 GAGGGGCAGCCTGAGGACGAGGG - Intronic
1066437455 10:35407309-35407331 AAGGAGCAGCCTGGGGAGGAGGG + Intronic
1066723946 10:38370303-38370325 GAGGGACAGGCAGAGCAGGACGG + Intergenic
1067051768 10:43025527-43025549 CAGGGGCAGGTGGAGGAGGAGGG - Intergenic
1067217166 10:44312768-44312790 CAGGCACAGCCTGAGGAGGTGGG - Intergenic
1068058437 10:52037810-52037832 GAGGAGCAGCCTGGGGAGGAAGG + Intronic
1068179744 10:53503081-53503103 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1068230884 10:54168419-54168441 GAGGAGCAGCCTGGGGAGGAAGG - Intronic
1068982399 10:63075389-63075411 CAGTGCCAGCCTGTGTAGGAAGG + Intergenic
1069567274 10:69472192-69472214 CAAGGACAGGCAGAGGATGAGGG - Intronic
1069835271 10:71304188-71304210 AAGGGACAGCTTCATGAGGATGG + Intergenic
1069936612 10:71921869-71921891 CAGGGCCAGCTTGGGCAGGAGGG - Intergenic
1070156678 10:73839732-73839754 CAGGGGCAGGCTGAGGAGGTAGG + Intronic
1070605484 10:77895265-77895287 AAGGGAAATCCTGGGGAGGAAGG - Intronic
1070712670 10:78694046-78694068 CTGGCAGGGCCTGAGGAGGAAGG + Intergenic
1070752989 10:78974781-78974803 CAGAGCCAGGCTGGGGAGGAAGG - Intergenic
1070822885 10:79373010-79373032 CAGAGAGCGCCAGAGGAGGAAGG + Intergenic
1071432674 10:85618660-85618682 CAAGGGAAGGCTGAGGAGGAGGG - Intronic
1071483903 10:86085332-86085354 CAGTGCCAGCCTCAGAAGGACGG + Intronic
1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG + Intergenic
1071563914 10:86661987-86662009 CAGGGAGAGCCTGGGGATGTTGG - Intronic
1071821644 10:89286324-89286346 TAGGAGCAGCCTGGGGAGGAGGG - Intronic
1071897819 10:90085087-90085109 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1072085592 10:92076511-92076533 TAGGGAGAGGCTGAGGAGGGAGG - Intronic
1072400397 10:95092796-95092818 CAGTGACAGGCTCAGGAGTAAGG - Intergenic
1072580174 10:96733888-96733910 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1072604819 10:96971587-96971609 CAGGGACAGGGTGCTGAGGAGGG + Intronic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1072884429 10:99261244-99261266 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1072996445 10:100249050-100249072 CAGGGGCAGCTGGAGGAGCATGG - Intronic
1073553710 10:104427782-104427804 TAGGGAGAGGCTGAGGAGGGAGG + Intronic
1074137885 10:110643969-110643991 CAGGGACAGCCGGAGGACTCAGG + Intergenic
1074150550 10:110755879-110755901 CAGGGCCAGGCTGAGGTGGTTGG - Intronic
1074361222 10:112825317-112825339 CAGGCACACCCTGTGGGGGAGGG + Intergenic
1074740684 10:116482310-116482332 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1074751514 10:116591658-116591680 CAGGGACAGTCTGAAGACAATGG - Intronic
1075102764 10:119517862-119517884 GAGGGACAGCCGGTGGAAGAGGG - Intronic
1075153639 10:119956430-119956452 GAGGAAGAGCCTTAGGAGGAGGG + Intergenic
1075216777 10:120543247-120543269 CAATGCCAGCTTGAGGAGGAAGG - Intronic
1076575262 10:131461616-131461638 CAGAGGCAGCCTCAGGAAGATGG - Intergenic
1076807296 10:132865370-132865392 CAGGGCCAGTCCCAGGAGGAGGG + Intronic
1077612093 11:3649566-3649588 GAGGAGCAGCCTGGGGAGGAGGG - Intronic
1077679213 11:4223668-4223690 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1077688649 11:4320310-4320332 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1077766478 11:5164365-5164387 AAGGAGCAGCCTGGGGAGGAGGG + Intronic
1077850881 11:6073885-6073907 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1077922875 11:6655001-6655023 CAGGCACAGCCTGAAGTGGATGG - Intronic
1077929419 11:6714925-6714947 CATTGACAGCCTGAGGACGGTGG + Intergenic
1078046212 11:7916209-7916231 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1078135153 11:8645705-8645727 CAAGGACAGGCTGAGGAGTTGGG + Intronic
1078187890 11:9068011-9068033 CAGGGACAGCCTGACTTCGAGGG + Intronic
1078413152 11:11144021-11144043 CAGGGACAGGCTGAGCAGGGCGG - Intergenic
1079031672 11:16990849-16990871 CAGGGAGACCCTCAGGAGCATGG + Intronic
1079151673 11:17905497-17905519 CAGGCTTAGTCTGAGGAGGAAGG + Intronic
1079727162 11:23891236-23891258 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1080027996 11:27633124-27633146 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1080874699 11:36265131-36265153 CAGTGACAGGATGAGGAAGAAGG - Intergenic
1080894331 11:36436500-36436522 TAGGGACAGCATCAGGAGGCAGG + Intronic
1081460002 11:43263791-43263813 CAGGGAGAAGCTGAGGAGGATGG - Intergenic
1081599630 11:44484191-44484213 CTCCGCCAGCCTGAGGAGGAGGG + Intergenic
1081669311 11:44934372-44934394 GAGGGCCAGATTGAGGAGGAGGG + Exonic
1083183872 11:61006497-61006519 CAGAGACACCCTGATGAGCAGGG - Intronic
1083475167 11:62910600-62910622 CAGGTACTGCCAGAAGAGGATGG + Exonic
1083490184 11:63009927-63009949 GAGGGCCAGGCTGAGGAGGGAGG + Intronic
1083609798 11:63999395-63999417 CAGGGGTAGCCTGAGGCGGGTGG + Exonic
1083727483 11:64636131-64636153 GATTGACAGCCAGAGGAGGAAGG + Intronic
1084106953 11:66986479-66986501 CAGAGACAGCCTCCTGAGGAGGG + Intergenic
1084540324 11:69782365-69782387 CTGGGAGACCCTGAGGAGGAGGG - Intergenic
1084651309 11:70491003-70491025 CTGGGACAGGCTGAAGAGGGAGG - Intronic
1084859559 11:72009378-72009400 CCTGGACAGCCTGAGAAGAAAGG + Exonic
1085109306 11:73873617-73873639 CAGGGAGGGACTGAGGGGGAAGG - Intronic
1085251032 11:75144239-75144261 CAGTGTCAGGCTGAGAAGGATGG + Intronic
1085339887 11:75724188-75724210 CTGGTACAGCCTCAGAAGGAAGG - Intronic
1085934175 11:81123479-81123501 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1086133065 11:83420758-83420780 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1087099011 11:94347350-94347372 GAGGCGCAGCCTGGGGAGGAGGG - Intergenic
1087127727 11:94643267-94643289 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1087314590 11:96589589-96589611 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1088328823 11:108629164-108629186 CAGGGACAGCCTGAGGCATGGGG - Intergenic
1089221241 11:116873641-116873663 CAGGAACAGAGTGGGGAGGACGG + Intronic
1089315311 11:117587401-117587423 CAGGGACAGCGTGATGGGGAGGG - Intronic
1089459392 11:118643866-118643888 GAGGAAGAGCCAGAGGAGGAGGG - Exonic
1089472179 11:118730211-118730233 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1089500521 11:118929113-118929135 CAGGGTCGGCCTGAGGAGTGTGG + Intronic
1089987349 11:122826284-122826306 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1090627378 11:128618697-128618719 CAGGAAGAGGCTGAGGAGCAAGG + Intergenic
1090958495 11:131535143-131535165 CTGGGACAGCCAAAGGACGATGG + Intronic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1091183578 11:133628449-133628471 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1091301499 11:134510764-134510786 CAGGGGCAGCTGGAGGAGCAGGG - Intergenic
1091456031 12:608621-608643 CAGGGACAGCCTGGTGGGCAAGG + Intronic
1092474401 12:8806599-8806621 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1092626835 12:10336976-10336998 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1092723803 12:11466218-11466240 GAGGAGCAGCCTGGGGAGGAAGG + Intronic
1093024231 12:14232222-14232244 CTGGCTCAGCCTGGGGAGGAGGG - Intergenic
1093071251 12:14708917-14708939 AAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1093302132 12:17471205-17471227 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1093812936 12:23510084-23510106 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1094108310 12:26835730-26835752 TAGGGACAGGGTGAAGAGGAAGG - Intergenic
1094826727 12:34275291-34275313 CAGGGACACCCTTGGGAGGGTGG + Intergenic
1095991491 12:48037597-48037619 CAGCTACAGACTGAGGGGGAGGG - Intergenic
1096530048 12:52236681-52236703 TAGGGACAACCTGGGGTGGAAGG - Intronic
1096591017 12:52659348-52659370 CAGATACAGCCAGAGCAGGAAGG + Intergenic
1097054697 12:56242609-56242631 CAGGGGCAGCTAGAGGATGAGGG - Exonic
1097417140 12:59327262-59327284 GAGGAACAACCTGGGGAGGAAGG + Intergenic
1098630121 12:72712952-72712974 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1098653920 12:73006042-73006064 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1098919809 12:76293094-76293116 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1099188623 12:79541532-79541554 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1099295420 12:80822879-80822901 CAGGGACAGCCTGAAGCCCAGGG + Intronic
1099762501 12:86940463-86940485 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1099836188 12:87911450-87911472 GAGGGGCAGCCTGGGGAGGAGGG + Intergenic
1100561255 12:95750753-95750775 GAGGAGCAGCCTGGGGAGGAAGG - Intronic
1102478971 12:113207793-113207815 CAGAAAGAGGCTGAGGAGGAAGG - Exonic
1103188527 12:118981399-118981421 GAGGCTGAGCCTGAGGAGGAGGG + Intergenic
1104067733 12:125319324-125319346 GAGGGACAGGCAGAGGAAGAGGG + Intronic
1104245618 12:127038317-127038339 CAGACACAGCTTGGGGAGGAGGG - Intergenic
1104576203 12:129968084-129968106 CAGCATCAGCCTGAGGAGCAGGG + Intergenic
1104682727 12:130762429-130762451 CAGGGAGTGCCTGGGGAGGGTGG + Intergenic
1104787829 12:131461279-131461301 CAGGGGCCACCTGGGGAGGATGG - Intergenic
1105241181 13:18610544-18610566 CACAGGCAGCTTGAGGAGGATGG + Intergenic
1105622310 13:22080276-22080298 GAGAGACAGCCTGATGTGGAGGG + Intergenic
1106049459 13:26176730-26176752 CAAGACCAGCCTGAGCAGGATGG + Intronic
1106576326 13:30979059-30979081 CAGGGAGAGCCTGAAGACTAGGG - Intergenic
1107589288 13:41884990-41885012 CAGTGAGACCCTGTGGAGGAGGG - Intronic
1107683232 13:42871461-42871483 GAGGAACAACCTGGGGAGGAAGG + Intergenic
1108320825 13:49288724-49288746 CAGGGACAAACAGAGAAGGAAGG + Intronic
1108512902 13:51171531-51171553 CAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1108913504 13:55582293-55582315 AAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1108919634 13:55659022-55659044 AAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1108947346 13:56041976-56041998 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1108953036 13:56116466-56116488 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1109011860 13:56959358-56959380 GAGGGACATCCTGAGGAGTGGGG - Intergenic
1109154193 13:58884560-58884582 CAGGGAGAGCCTGAGCAGCCAGG - Intergenic
1109343492 13:61089990-61090012 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1109499207 13:63214787-63214809 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1109506932 13:63313883-63313905 CATGGACATACAGAGGAGGAAGG - Intergenic
1109683532 13:65784150-65784172 CAGGAACAGCCTGAAGACTAAGG - Intergenic
1109716837 13:66230422-66230444 CAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1110765380 13:79275798-79275820 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1110978390 13:81867803-81867825 GAGGGGCAGCCTGGGGAGGAGGG - Intergenic
1111301959 13:86360072-86360094 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1111362214 13:87190523-87190545 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1113400908 13:109992565-109992587 CTGGAGCAGCCTGAGGAGGGGGG - Intergenic
1113629963 13:111875420-111875442 CAGAGAGAGGCTGAGGATGATGG - Intergenic
1113728316 13:112622358-112622380 CAGGGACAGCTAGGGGAGGCAGG - Intergenic
1113940368 13:114015755-114015777 TGGGGACAGCCTGGGGAGGCAGG + Intronic
1114771149 14:25429780-25429802 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1115753412 14:36512620-36512642 CAGGGAGAGCCAGAGGAACATGG + Intronic
1115904718 14:38192455-38192477 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1116179588 14:41517621-41517643 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1116490684 14:45499467-45499489 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1116534866 14:46016451-46016473 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1116613422 14:47105837-47105859 GAGGAGCAGCCTGGGGAGGAGGG - Intronic
1117174064 14:53130086-53130108 GAGGAGCAGCCTGGGGAGGAGGG - Intronic
1118878986 14:69810302-69810324 CAGGGACAGCAGGAGGAGCTGGG - Intergenic
1119022337 14:71125958-71125980 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1119317110 14:73705156-73705178 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1120438146 14:84504254-84504276 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1121790588 14:96696748-96696770 CAGGAACAGCCTGCTGGGGATGG + Intergenic
1121808608 14:96857323-96857345 CAGGGACAGCCTCACTTGGAAGG + Intronic
1122040907 14:98986864-98986886 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1122229264 14:100297379-100297401 CAGGGGCTGCCTGAGGGGGCCGG + Intronic
1122381421 14:101309727-101309749 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1122520699 14:102341606-102341628 CTGGGACAGCCTGAGGAGCCCGG + Exonic
1122704511 14:103611761-103611783 CAGGGACTGAGTGAGGGGGATGG + Intronic
1122898628 14:104772815-104772837 CAGGTGCAGCCTGGGGATGAGGG + Intronic
1123490174 15:20774603-20774625 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1123546675 15:21343690-21343712 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1123882578 15:24689598-24689620 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1124229425 15:27930683-27930705 CAGAGACTGCCTGAGGATGGAGG + Intronic
1124612032 15:31215612-31215634 CGGGGACAGCGTCCGGAGGAGGG + Intergenic
1124694521 15:31852954-31852976 CAGGGACAGGCTGAGGAGGTGGG + Intronic
1125131603 15:36289688-36289710 TAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1125226888 15:37405583-37405605 CAAGGACAGCATCAAGAGGATGG + Intergenic
1125515820 15:40320484-40320506 CCGGGTCAGCCTCAGGAGGGAGG - Intergenic
1125542612 15:40478946-40478968 CAGGGGCAGCCTGAGAGGGAAGG + Intergenic
1125609533 15:40961112-40961134 CCAGGGCAGGCTGAGGAGGAAGG - Intergenic
1126130120 15:45332823-45332845 CCGGCTCAGCCTGAGGAGGCTGG - Intergenic
1126269075 15:46791564-46791586 CAGGAAAATCGTGAGGAGGAGGG + Intergenic
1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG + Exonic
1126379214 15:48028964-48028986 CAGTGACAGCCAGAGCAGAACGG - Intergenic
1126448330 15:48776400-48776422 TAGGGACAGCCTCAGGACGTGGG + Intronic
1126530247 15:49703193-49703215 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1128261472 15:66235947-66235969 TAGTGAGAGCCTCAGGAGGAGGG - Intronic
1128315622 15:66657481-66657503 GAGGGGGAGCCTGAAGAGGAAGG - Intronic
1128550680 15:68596265-68596287 CAGGGACAGGCCCAGGAGGATGG + Intronic
1128987259 15:72230668-72230690 CACGCACAGCTTGAAGAGGAGGG + Intronic
1129183556 15:73891981-73892003 CAGGGACAGTCTGAGGACTAGGG + Intergenic
1129388580 15:75209099-75209121 AAGGCACAGGCAGAGGAGGAGGG - Intronic
1129771560 15:78206365-78206387 CAGGGACAGGCTGAGGAAGGAGG - Intronic
1129777638 15:78247148-78247170 CATGGAGTGACTGAGGAGGACGG + Intergenic
1129869955 15:78933751-78933773 GAGGGAGAGCCTGAGAGGGAGGG - Intronic
1130018171 15:80203150-80203172 CAGGGACAGCTTTAGGAGGAGGG + Intergenic
1130041155 15:80405794-80405816 AAAGGACAGACTGAGGAGTATGG + Intronic
1130843396 15:87722855-87722877 CTGAGACAGGGTGAGGAGGATGG + Intergenic
1130947566 15:88560521-88560543 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1131033653 15:89206973-89206995 CAGGGACAAGCTGGGCAGGAGGG - Intergenic
1132092524 15:98957728-98957750 CAGGGACAGAGTGAGGAGACTGG - Exonic
1132208049 15:99999856-99999878 GAGGGACAACCTGGGGTGGAGGG - Intronic
1132240623 15:100254832-100254854 CAGGGCCAGCCGGGGGAGGCGGG + Intronic
1132340317 15:101074201-101074223 AAGGAGCAGCCTGGGGAGGAGGG - Intronic
1202955006 15_KI270727v1_random:70905-70927 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1132671630 16:1104292-1104314 AAGGGAAGGCCTGGGGAGGAAGG + Intergenic
1132950677 16:2560630-2560652 GGGGGACGGCCTGAGGAGCAGGG - Intronic
1132963673 16:2639540-2639562 GGGGGACGGCCTGAGGAGCAGGG + Intergenic
1132973059 16:2698300-2698322 CGGGGAGACCCTGAGGTGGATGG + Intronic
1133102215 16:3486391-3486413 CTGCCCCAGCCTGAGGAGGAGGG + Exonic
1133132737 16:3687737-3687759 CAGCCAGAGGCTGAGGAGGAAGG + Intronic
1133294091 16:4742107-4742129 CAGAGTGAGTCTGAGGAGGAGGG - Intronic
1133651309 16:7816367-7816389 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1133724880 16:8528099-8528121 CAAGGACAGCCTGGGCAGCATGG - Intergenic
1133938085 16:10284793-10284815 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1134342269 16:13356613-13356635 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1135137970 16:19898661-19898683 CAGCCACAGCCTGAGAAGGGAGG - Intergenic
1136029907 16:27495294-27495316 CAGGCACTTCCAGAGGAGGACGG + Exonic
1136240236 16:28938911-28938933 CAGACCCAGCCTGGGGAGGAGGG + Exonic
1136293514 16:29289570-29289592 CTGGGACCTCCTGAGGAGGGTGG + Intergenic
1137853105 16:51765927-51765949 CAGGGACAGCGTGCTGGGGAGGG + Intergenic
1138759196 16:59521686-59521708 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1138804856 16:60080498-60080520 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1139226007 16:65233876-65233898 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1139344403 16:66293331-66293353 GAGGGACAGCCTGAGCGGGAAGG - Intergenic
1139517237 16:67459306-67459328 CAGGGCCGGCCTGTGGAGGTGGG - Intronic
1139854154 16:69967561-69967583 CAGGGACAGCTTGAGAAGCTGGG - Intergenic
1139883135 16:70190475-70190497 CAGGGACAGCTTGAGAAGCTGGG - Intergenic
1140369373 16:74405045-74405067 CAGGGACAGCTTGAGAAGCTGGG + Intergenic
1141075618 16:81004409-81004431 CAGGGACTGCCTGGGGAGGAAGG + Intronic
1141276127 16:82589829-82589851 TAGGGACTACCTGAGGTGGAAGG - Intergenic
1141712764 16:85709667-85709689 CAGGGAGAGGGTGAGGAGGTGGG - Intronic
1141859942 16:86709689-86709711 CAGGGACTGGATGCGGAGGACGG + Intergenic
1141980096 16:87544875-87544897 CAGAGACTGCCAGAGGTGGAAGG + Intergenic
1142001870 16:87668877-87668899 CCGGGACAGCCGGAGGGGGTGGG - Intronic
1142099394 16:88263576-88263598 CTGGGACCTCCTGAGGAGGGTGG + Intergenic
1142218970 16:88843667-88843689 CCTGGAGAGCCTGAGGGGGAGGG + Intronic
1142290667 16:89192489-89192511 AGGGGACGGCCTGGGGAGGAGGG - Intronic
1142483933 17:234850-234872 CAGGGACAGAGAGAGAAGGAAGG + Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142961930 17:3556792-3556814 CAGTCACGGCCTGATGAGGATGG + Intronic
1143120272 17:4602282-4602304 CAGGGACAATCTGGGGTGGAAGG + Intronic
1143465100 17:7131266-7131288 GAGAGAGAGCCTGTGGAGGAGGG - Intergenic
1143617619 17:8063216-8063238 CCTGCATAGCCTGAGGAGGAGGG + Intergenic
1143712750 17:8745288-8745310 CGGGGACAGGCACAGGAGGAGGG + Intergenic
1144584601 17:16480708-16480730 GAGGGACAGCCTCAGGAGAGGGG - Intronic
1145061626 17:19737750-19737772 CAAGGAGAGCCTGAGGAGGCTGG - Intergenic
1145080763 17:19892503-19892525 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1145266569 17:21382645-21382667 CATGGACATCCAGGGGAGGAGGG - Intronic
1145861539 17:28215230-28215252 CAGGGACATCCTGAGTAGCCGGG - Intergenic
1145897238 17:28466241-28466263 CAAGCAGAGGCTGAGGAGGAAGG + Intronic
1146399459 17:32491862-32491884 CAGCGTCAGCCTCAGGAAGAGGG + Intergenic
1146429131 17:32773996-32774018 AAGGCACAGCCTGGGGAGGAGGG - Intronic
1146597809 17:34184940-34184962 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1147135269 17:38430409-38430431 CAGGGTCAGCCCGAGGAGAGGGG - Intronic
1147782515 17:42953847-42953869 CAAGGCCAGCCTCAGAAGGAGGG - Intronic
1147892242 17:43725564-43725586 CAGGGCCTGGCTCAGGAGGAGGG - Intergenic
1147951949 17:44112367-44112389 GAGGCACAACCTGAGGAGCAGGG - Intronic
1147952169 17:44113304-44113326 CAGGGACACCCAGAGGTGGCTGG + Intronic
1148323147 17:46769586-46769608 CAGGAACTGCCCAAGGAGGAAGG + Intronic
1148615174 17:48996198-48996220 CAGGAACGGCGGGAGGAGGAGGG + Intergenic
1148794850 17:50192015-50192037 CAGGAACACCCTGAGGGGGAGGG + Exonic
1148820041 17:50354951-50354973 CAGGTACATCCTCAGGAGGCTGG - Exonic
1149207321 17:54263663-54263685 CAGGGAGAACCTGAGCAGGTGGG + Intergenic
1149319424 17:55469126-55469148 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1150307589 17:64099742-64099764 CTGGGGCAGCCTGAGGTGGCAGG + Intronic
1150442719 17:65204150-65204172 CAGGAACAGCCTGGGGTGGGAGG - Exonic
1150480309 17:65503996-65504018 CAGGGAAAGCCTGGGGATGGAGG + Intergenic
1151511962 17:74566248-74566270 CAGGCACAGGCTTAGGAGCAAGG + Intergenic
1152059775 17:78063375-78063397 GAGGAGCAGGCTGAGGAGGAAGG + Intronic
1152241912 17:79165410-79165432 CTGGGAAAGCCTGGGAAGGAGGG + Intronic
1152727089 17:81952798-81952820 CAGGGAAAGCCGGGGCAGGAGGG + Exonic
1152734095 17:81988504-81988526 CAGGGACAGCAGGAGGTGGTGGG + Intronic
1152797704 17:82316225-82316247 CAGGCCCAGCCCGAGGAGGAAGG + Exonic
1153427987 18:4987584-4987606 CAGGGACAGCCTGATGTCTAGGG - Intergenic
1153615550 18:6929964-6929986 CGGGGTCAGCCTGCGGTGGAGGG - Intergenic
1154447777 18:14449357-14449379 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1155287833 18:24309425-24309447 GAGGGAAAGGCTGAGGTGGAAGG - Intronic
1155941458 18:31805441-31805463 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1156938437 18:42738286-42738308 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1157049500 18:44145306-44145328 CAGGGACAAGCTGAGAGGGAGGG + Intergenic
1157220583 18:45826151-45826173 TGGGCACAGCCTGAGGAAGAAGG + Intronic
1157506664 18:48231200-48231222 CAGGGACAGCCTGAGGCCTGGGG + Intronic
1157513084 18:48292490-48292512 CAGGGACAGGCGCAGGAGGAGGG - Intronic
1157585974 18:48801381-48801403 GAGGAACAGCCGGAGGCGGAGGG - Intronic
1157906492 18:51574117-51574139 GAGGGGCAGCCTGGGGAGGAGGG + Intergenic
1158394732 18:57070673-57070695 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1158473080 18:57755865-57755887 CAGGGACAGACAGATGAAGAGGG + Intronic
1158576795 18:58645035-58645057 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1158617984 18:59005433-59005455 CTGGGACAGAATGAGGAGGGAGG + Intergenic
1158892818 18:61889018-61889040 CAGGCACAGACTGAGGGAGAAGG - Intronic
1159164377 18:64683296-64683318 AAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1159834962 18:73326314-73326336 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1160191125 18:76714668-76714690 CAGAGACAGACTCAGGAGGGTGG - Intergenic
1160385542 18:78494209-78494231 CAGTGACACACTGAGGGGGACGG - Intergenic
1160494687 18:79365924-79365946 CAGGGACAGCCTGTGTGTGATGG + Intronic
1160507962 18:79437708-79437730 CAGGCTCTGCCTGAGGGGGAGGG + Intronic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1160899727 19:1421671-1421693 CTGGGACAGCCGGAGGGGGCCGG + Intronic
1161012554 19:1967678-1967700 TGGGGGCAGCCTGGGGAGGAGGG - Intronic
1161012575 19:1967738-1967760 CGGGGGCAGCCTGGGGAGGAGGG - Intronic
1161012596 19:1967799-1967821 CGGGGGCAGCCTGGGGAGGAGGG - Intronic
1161012618 19:1967860-1967882 CGGGGGCAGCCTGGGGAGAAGGG - Intronic
1161012639 19:1967921-1967943 CGGGGGCAGCCTGGGGAGAAGGG - Intronic
1161012657 19:1967975-1967997 CGGGGGCAGCCTGGGGAGGAGGG - Intronic
1161012677 19:1968030-1968052 TGGGGGCAGCCTGGGGAGGAGGG - Intronic
1161012699 19:1968090-1968112 CGGGGGCAGCCTGGGGAGGAGGG - Intronic
1161012735 19:1968198-1968220 CTGGGGCAGCCTGGGGAGGAGGG - Intronic
1161012753 19:1968252-1968274 CGGGGGCAGCCTGGGGAGGAGGG - Intronic
1161012773 19:1968307-1968329 CAGGGGCAGCCTGGGGAGGAGGG - Intronic
1161012794 19:1968368-1968390 TCGGGACAGCCTGGGGAGGAGGG - Intronic
1161711940 19:5853738-5853760 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1161739513 19:6012007-6012029 CACAGACAGCATGAGGATGATGG - Intronic
1161943915 19:7422562-7422584 CTGGGGTGGCCTGAGGAGGAAGG - Intronic
1162212449 19:9103148-9103170 CAGGAACAGGCTGAAAAGGACGG + Exonic
1162215013 19:9126855-9126877 CAGGAACAGCATGAAGAGGATGG + Exonic
1162222634 19:9191302-9191324 CAGGAACAGCCCAAAGAGGATGG - Intergenic
1162223976 19:9204378-9204400 CAGGAACAGCCCAAAGAGGACGG - Intergenic
1162225140 19:9214742-9214764 CAGGAACAGCCCAAAGAGGACGG + Exonic
1162227399 19:9235217-9235239 CAGGAACAGCCCAAAGAGGACGG - Intergenic
1162231002 19:9266220-9266242 CAGGAACAGCCCAACGAGGACGG + Intergenic
1162261898 19:9540688-9540710 GAGGAGCAGCCTGAGGGGGAGGG - Intergenic
1162424168 19:10583982-10584004 CTGGTACAGCGGGAGGAGGAAGG - Exonic
1162691713 19:12439407-12439429 AGGGGACAGCCTGAGATGGAAGG - Intronic
1162763679 19:12904491-12904513 CAGGAACAGCCTGAAGACCAAGG - Exonic
1162953883 19:14088004-14088026 CAGGGGCAGACTGAGAAGGGGGG + Exonic
1163069613 19:14828146-14828168 CAGGAACAGCCCAAAGAGGAAGG + Exonic
1163071058 19:14841782-14841804 CAGGAACAGCCCAAAGAGGAAGG + Exonic
1163073333 19:14864620-14864642 CAGGAACAGCCCAAAGAGGAAGG + Intergenic
1163548685 19:17953182-17953204 CTTGGGCAGCCTGAGGAGGCTGG - Intronic
1163635501 19:18435361-18435383 CAGGGACAGCACGGGGTGGAAGG + Exonic
1163769257 19:19180723-19180745 CAGGATCAGGCTGAGGAGGGCGG + Exonic
1163828789 19:19538113-19538135 CCAGGACAGCCTGAGGACGGAGG + Intergenic
1163917791 19:20257719-20257741 GATGGACAGCCAGAGCAGGAAGG + Intergenic
1164004179 19:21133845-21133867 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1164152884 19:22569906-22569928 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1164510027 19:28889282-28889304 CAGGGACAGCATGAGGCAGGAGG - Intergenic
1164566157 19:29327484-29327506 CAGGGAGAGGCTGGGGAGGCGGG - Intergenic
1164789386 19:30963247-30963269 CAGGAAGACCCTGAGGAGGTGGG - Intergenic
1165249144 19:34515624-34515646 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1165379585 19:35468876-35468898 CAGGCAGAATCTGAGGAGGATGG - Intergenic
1165417704 19:35704861-35704883 CGAGGCCAGCCTGAGTAGGAAGG + Intronic
1165961679 19:39539952-39539974 CCGGCACAGCCTGAGGAGGCCGG - Exonic
1166102699 19:40580562-40580584 CAAGGACAACCTGAGGAGCCGGG + Exonic
1166141726 19:40808766-40808788 CAGGTGCAGGCAGAGGAGGAAGG - Intronic
1166679596 19:44758726-44758748 CATCGACATCCTGAGGGGGAAGG + Exonic
1166707197 19:44914615-44914637 CAGGGGAAGGCTCAGGAGGAGGG + Intronic
1166709302 19:44926711-44926733 CAGGGGAAGGCTCAGGAGGAGGG + Intergenic
1166755090 19:45185716-45185738 CAGGGCCAGAATGAGGAGCAGGG + Intronic
1166905897 19:46108132-46108154 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1167165768 19:47798900-47798922 AAGGGAGAGACTGAGGGGGAGGG - Intergenic
1167377439 19:49119513-49119535 CAGTGAGAGCGTGAGGGGGAGGG + Exonic
1167591485 19:50406775-50406797 CAGGGCCAGAGGGAGGAGGAGGG - Intronic
1167705684 19:51079659-51079681 CAAGCACAACCTGAGGAGGTGGG - Exonic
1167902059 19:52629437-52629459 AAGGAGCAGCCTGGGGAGGAGGG - Intronic
1168514980 19:57003629-57003651 CAGGGGCTGCAAGAGGAGGAGGG - Intergenic
925544463 2:5002646-5002668 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
925747672 2:7057366-7057388 TAGGGACAGCTTAATGAGGAAGG + Intronic
925828910 2:7876705-7876727 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
926774105 2:16405099-16405121 CAGGCACAGCCAGAGCAGGTGGG + Intergenic
926815639 2:16795985-16796007 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
928261394 2:29770140-29770162 CAGGCACAGTTAGAGGAGGAGGG + Intronic
928366531 2:30707145-30707167 AAGTGACAGCCTGAGGAGGAGGG + Intergenic
928778211 2:34791363-34791385 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
929311245 2:40428526-40428548 AAGGGACTGCCAGAGGTGGAGGG - Exonic
929684630 2:44023113-44023135 CAGGAGCAGCCTGGGGAGAAGGG + Intergenic
930927377 2:56835011-56835033 CAGAGACAGTCTGAAAAGGAGGG + Intergenic
932159556 2:69447733-69447755 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
932306400 2:70706566-70706588 GAGGCAGAGCCTGGGGAGGAGGG + Intronic
932350690 2:71029002-71029024 CAGGGACAGCCCAGCGAGGATGG - Intergenic
932432790 2:71685700-71685722 CAGGGCCAGCGTGGGGAGGCAGG + Intronic
932445686 2:71779667-71779689 CAGGGACAGACTGAGGTGGGTGG - Intergenic
932447654 2:71790719-71790741 CTGGCCCAGCCTGAGAAGGACGG + Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
932854298 2:75217834-75217856 AAGGAGCAGCCTGGGGAGGAAGG + Intergenic
933552486 2:83792960-83792982 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
933878394 2:86643645-86643667 CAAGGACAGCATCAAGAGGATGG - Intronic
934059959 2:88284281-88284303 CAGGGCCAGGCGGAGGCGGAGGG - Intergenic
934590585 2:95546660-95546682 CAGGGACAGCCCAGGGAGGACGG - Intergenic
935657593 2:105438335-105438357 CAGAGACAGGCTGGGAAGGATGG + Intronic
936075220 2:109397520-109397542 CAAGTACAGCCTAAGAAGGAAGG + Intronic
937095374 2:119232051-119232073 CAGAAACAGCCTGAGAATGAGGG + Intronic
937330189 2:121021749-121021771 CAGGGAGAGCCAGGGGAGAAGGG + Intergenic
937436379 2:121885121-121885143 CAGGGACAGCATCAGAATGATGG + Intergenic
937988073 2:127647570-127647592 GAGGGACAGCCTGGGGTGGAGGG + Intronic
938213009 2:129484395-129484417 CAGTGACCTCCTGAGGAGCAGGG - Intergenic
938218901 2:129548805-129548827 CTGGGGCAGCCAGAGGGGGAAGG - Intergenic
938226965 2:129624731-129624753 CAGGAACAGTCAGAGGAGAAGGG + Intergenic
939083233 2:137687015-137687037 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
939460826 2:142493913-142493935 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
939847988 2:147270696-147270718 AAGAGACAGGCTGAGGAAGAAGG + Intergenic
940182844 2:150954687-150954709 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
940530099 2:154868988-154869010 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
940675895 2:156724113-156724135 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
941037567 2:160584873-160584895 CAGGGACAGAGTTAGCAGGAAGG + Intergenic
941625649 2:167827590-167827612 CAGGGACTGCCAGAGAGGGAAGG - Intergenic
941753637 2:169161672-169161694 CAGGAACAGCCTGGGCAGCATGG - Intronic
941819418 2:169828980-169829002 CAGGGACAGTCTGAGAAAAAAGG + Intronic
941935988 2:170981705-170981727 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
942313351 2:174676504-174676526 CAAGAACAGCCTGAGCAGCATGG - Intronic
942744823 2:179220183-179220205 AAGGGACAGAGTGAGGAGGATGG - Intronic
942827382 2:180195131-180195153 CAGGAGCAGCCTCAGTAGGAAGG - Intergenic
943061488 2:183045538-183045560 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
943413021 2:187564522-187564544 GAGGAGCAGCCTGGGGAGGAAGG + Intronic
943450034 2:188034870-188034892 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
943744002 2:191441984-191442006 CTGGCACCGCCTGAGGCGGAGGG + Intergenic
944387357 2:199181038-199181060 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
944394046 2:199248592-199248614 AAGGAGCAGCCTGGGGAGGAAGG - Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945938224 2:215924038-215924060 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
946871857 2:224091919-224091941 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
946886405 2:224226953-224226975 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
947367305 2:229409992-229410014 TAGGGACCTCCAGAGGAGGAGGG - Intronic
947433737 2:230054070-230054092 CAGGTGCAGCCTGAGGTGGGGGG + Intronic
947446501 2:230167667-230167689 CAGGGACAGATTCAGAAGGAGGG - Intronic
948390594 2:237608622-237608644 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
948434526 2:237944106-237944128 CAGGGACAGCCTGAAGCCTAGGG + Intergenic
948560722 2:238849328-238849350 CAGGGTTTGCCTGGGGAGGACGG + Intronic
948737047 2:240015954-240015976 CAGGACCAGCCTGAGCAGCATGG + Intronic
948877503 2:240837507-240837529 CAGGGACAGGCTGAGGAGGTAGG - Intergenic
948909315 2:240995135-240995157 CAGGGACAGCCAGCAGTGGAGGG - Intergenic
1168983408 20:2026895-2026917 CAGGGACAGCCTGAGGCCTGGGG - Intergenic
1168996929 20:2140300-2140322 CAGGCACAGCCTGAGCAGTCAGG + Intronic
1169220379 20:3819099-3819121 AACGGGCAGCCTGAGCAGGAAGG + Intergenic
1169291795 20:4359222-4359244 CAGGGAGACCCTGGGGAGCAGGG - Intergenic
1169880498 20:10341654-10341676 CAGGGATAGCCTGAAGACTAGGG + Intergenic
1169900876 20:10550630-10550652 CCTGGACAGGCTGAGGAGGCTGG - Intronic
1170606707 20:17880120-17880142 CAAGGCCAGCCTGAGCAGCATGG + Intergenic
1171179832 20:23084396-23084418 CAGGGCCAGCAGGAGTAGGATGG + Exonic
1171387111 20:24778023-24778045 CGGGGACAGCCTGAGGACTCAGG + Intergenic
1172221281 20:33276726-33276748 CAGGGACAGCCTGAGGAGGAGGG + Intronic
1172699269 20:36843018-36843040 CAGTGGCAGCATGAGGAGGGAGG - Intronic
1172777175 20:37414549-37414571 CAGAGACAGCGAGGGGAGGAAGG - Intergenic
1172793449 20:37521574-37521596 GAGGGTCAGCGCGAGGAGGACGG - Intronic
1173156461 20:40616405-40616427 CAAGGACAGACTGAGCAGCAGGG - Intergenic
1173750091 20:45469816-45469838 CAGCAGCAGGCTGAGGAGGAGGG - Exonic
1174175653 20:48643040-48643062 CAGTGACAGCCTGAGAACCAAGG + Intronic
1174428085 20:50447622-50447644 CAAGGAAGGCCTTAGGAGGAAGG + Intergenic
1174522848 20:51145094-51145116 CAGAGACAGCCACAGAAGGAGGG + Intergenic
1175426070 20:58867878-58867900 CAGGGACAGCTTGAGAAAGGAGG + Intronic
1175968782 20:62673463-62673485 CAGTGACACCCGGAGGAGGCAGG - Intronic
1176379592 21:6105436-6105458 CCAGCACCGCCTGAGGAGGAGGG - Intergenic
1176385576 21:6137346-6137368 TCCGGGCAGCCTGAGGAGGAGGG - Intergenic
1177031268 21:15983860-15983882 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1179387464 21:40956616-40956638 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1179422646 21:41248912-41248934 CAGGGAGAGTCCAAGGAGGAGGG - Intronic
1179481513 21:41681639-41681661 CAGGAACAGCCTGAGCAGGGTGG + Intergenic
1179737897 21:43400906-43400928 TCCGGGCAGCCTGAGGAGGAGGG + Intergenic
1179743882 21:43432801-43432823 CCAGCACCGCCTGAGGAGGAGGG + Intergenic
1179965278 21:44801363-44801385 CAGTGAGAGCTTGAGGAAGAAGG - Intronic
1180326336 22:11433492-11433514 CAGGGCCAGCCTGACCAGCAAGG - Intergenic
1182010011 22:26992803-26992825 CAGGGGCAGCCTTGGGAGAATGG + Intergenic
1182268648 22:29138760-29138782 CTGGGACAGTCTGAGGTGGGTGG - Exonic
1182441891 22:30369552-30369574 CTGGGACAGCCTGCTGAGGCTGG + Exonic
1182998511 22:34835970-34835992 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1183640903 22:39091831-39091853 GAGGGACAGCATGAGGGGCAGGG + Intergenic
1183987019 22:41575568-41575590 CACTGCCAGGCTGAGGAGGAGGG - Exonic
1184256990 22:43292966-43292988 CTGGGGAAGCCTGGGGAGGAGGG + Intronic
1184458853 22:44626027-44626049 TGGGGGCAGCCTGAGGAGGAGGG - Intergenic
1184653639 22:45930635-45930657 CAGGAGCAGCCTGAGGAAGGTGG - Intronic
1184717414 22:46289928-46289950 CAGGGAGAGCCTGTGAAGGTCGG - Intronic
1184800116 22:46753925-46753947 CATGGACATCCTGAGGGTGAGGG - Intergenic
1184923554 22:47622411-47622433 CAGGGCCAGATTGGGGAGGAAGG + Intergenic
1184991427 22:48172738-48172760 CAGGAACAGCCTCAGGAGAGGGG + Intergenic
1185056948 22:48586106-48586128 CAGAGGCTTCCTGAGGAGGAAGG + Intronic
1185072900 22:48667028-48667050 CAGGGACAGCCTGGGATTGAGGG + Intronic
1185103781 22:48855868-48855890 CAGGGACAGTCTGAGGACTTGGG + Intergenic
1185227757 22:49662810-49662832 CCGGGTCAGCCTCGGGAGGAAGG + Intergenic
949162187 3:894720-894742 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
949407546 3:3730771-3730793 CAAAGACAGCCTGAGAAGGAGGG - Intronic
949518658 3:4829870-4829892 CAGAGACAGCCTGAGGCTCAGGG - Intronic
949671060 3:6399320-6399342 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
949827351 3:8178682-8178704 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
949885296 3:8688265-8688287 CAGGGACAGCCCAGCGAGGACGG - Intronic
950011315 3:9726048-9726070 CAGCGTGAGTCTGAGGAGGAGGG + Exonic
950479809 3:13237287-13237309 CAGGGACACCCTGTGGAAGGTGG + Intergenic
950497872 3:13345020-13345042 TAGGGACAGCCTGGAGGGGAAGG - Intronic
951298900 3:20971566-20971588 GATGAGCAGCCTGAGGAGGAGGG + Intergenic
951587553 3:24230987-24231009 CACAGACAGCCTGAAGTGGAAGG + Intronic
951762893 3:26164440-26164462 GAGGGGCAGCCTGGGGAGGAGGG + Intergenic
951889081 3:27552208-27552230 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
952085448 3:29815004-29815026 AAAAGACATCCTGAGGAGGAGGG + Intronic
952663549 3:35878399-35878421 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
952895346 3:38075087-38075109 CATGAGCAGCCTGAGGAGGAGGG + Intronic
952958449 3:38575246-38575268 CAGGGACGGCTGGAGGAGGAGGG - Intronic
953599537 3:44349075-44349097 AAGGAGCAGCCTGGGGAGGAGGG + Intronic
953841262 3:46391817-46391839 GAGGAACAGCCTGGGGAGGAGGG + Intergenic
953878278 3:46678709-46678731 CAGGCAACGCCTGAGGAGGGCGG + Intronic
953886216 3:46715688-46715710 AAGCCACAGGCTGAGGAGGAAGG + Exonic
954134976 3:48578346-48578368 CAGGGAAAGCCAGGCGAGGATGG - Exonic
954135552 3:48580588-48580610 CAGGGAGATCCTGGAGAGGATGG - Exonic
954292873 3:49658931-49658953 GAGTGCCAGGCTGAGGAGGATGG + Intronic
954870579 3:53764661-53764683 CAGGGGCAGCGGGAGGAGCAGGG - Intronic
954969354 3:54638527-54638549 AAGGAGCAGCCTGGGGAGGAAGG + Intronic
954984403 3:54776818-54776840 CAGGGATAGTCTATGGAGGAAGG - Intronic
955253272 3:57305335-57305357 GAGGAGCAGCCTGGGGAGGAGGG - Intronic
956846088 3:73184131-73184153 CAGGGACTACTTGAGGTGGAGGG - Intergenic
956961626 3:74409121-74409143 CAGAGACAGCCTCAGGTGAATGG - Intronic
957317398 3:78587191-78587213 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
957614050 3:82505762-82505784 CAGGGACAGCCTGAAGCCTAGGG + Intergenic
957904947 3:86542502-86542524 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
958676911 3:97277030-97277052 AAGGAGCAGCCTGGGGAGGAGGG + Intronic
958803049 3:98778475-98778497 CAAGGAGAGCTTGAGGATGAGGG + Intronic
959288440 3:104443962-104443984 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
959981736 3:112525057-112525079 CAGGGACAGCCCAGCGAGGACGG + Intergenic
961110830 3:124281680-124281702 CAGGGACAATTTGAGGGGGATGG - Intronic
961711718 3:128833232-128833254 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
961880963 3:130060938-130060960 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
962479698 3:135787739-135787761 AAGAGTCAGCCTGGGGAGGAGGG - Intergenic
963319641 3:143798913-143798935 AAGGAGCAGCCTGGGGAGGAGGG - Intronic
963425124 3:145114611-145114633 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
963468524 3:145712030-145712052 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
963663247 3:148153316-148153338 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
963684240 3:148416013-148416035 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
963842048 3:150117689-150117711 GAGGGTCAGCCTAAGGAGGATGG - Intergenic
964067737 3:152598657-152598679 GAAGAGCAGCCTGAGGAGGAGGG - Intergenic
964125548 3:153230769-153230791 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
964472670 3:157071146-157071168 CAGGATCAGCTTGAGGAAGAGGG - Intergenic
964983551 3:162714045-162714067 AAGGAACAGCCTGGGGAAGAGGG - Intergenic
965262747 3:166504857-166504879 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
965626408 3:170687397-170687419 GAGGAGCAGCCTGGGGAGGAGGG + Intronic
965640138 3:170822032-170822054 GAGGAGCAGCCTGGGGAGGAGGG + Intronic
965713312 3:171578081-171578103 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
965774308 3:172212451-172212473 CAGGGATGGCCTGAGGAAGTTGG + Intronic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
966398541 3:179524988-179525010 GAGGAACAGCCTGGGGAGGAGGG + Intergenic
966594263 3:181712129-181712151 CAGGATCGGCCAGAGGAGGAGGG + Exonic
966822785 3:183938262-183938284 CAGCTTCAGCCTGAGAAGGAAGG + Intronic
967049447 3:185769205-185769227 CATGGGGAGGCTGAGGAGGATGG + Intronic
967496129 3:190146186-190146208 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
967624740 3:191670531-191670553 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
967740395 3:192997318-192997340 GAGGACCAGCCTGGGGAGGAGGG - Intergenic
967911511 3:194546132-194546154 CCGGGACAGCCTCAGGATGGGGG - Intergenic
968574661 4:1360023-1360045 CAGGCACAGGCAGGGGAGGAGGG + Intronic
968578147 4:1377433-1377455 TAGGGACAGTGTGAGGAGGGAGG + Intronic
968993297 4:3929042-3929064 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
969042207 4:4307904-4307926 CAGAGAAAGCATGAGAAGGATGG - Intronic
969413609 4:7044711-7044733 CCCGGGCACCCTGAGGAGGAGGG + Intronic
969689109 4:8694554-8694576 CAGGGAGAGCAGGTGGAGGAAGG + Intergenic
970043182 4:11819967-11819989 CAGGGACTTCCTCAGGAGGGAGG + Intergenic
970695771 4:18675191-18675213 CAGGAAGAGCCTGAGGATAAAGG + Intergenic
971172084 4:24243730-24243752 AAGGGCCAGGCTAAGGAGGAAGG - Intergenic
971308789 4:25506351-25506373 CAGGGACGGCATGGGGTGGAAGG - Intergenic
975529594 4:75386444-75386466 CACGCACAGCCTGGGCAGGAAGG + Intergenic
975865177 4:78717906-78717928 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
975933981 4:79558026-79558048 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
976696445 4:87923531-87923553 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
976740050 4:88347805-88347827 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
976884666 4:89968841-89968863 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
977010226 4:91625753-91625775 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
977013017 4:91658671-91658693 GAGGAACAGCCTGGGGAGGAAGG + Intergenic
977062600 4:92275540-92275562 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
977075300 4:92443008-92443030 GAGGAGCAGCCTGGGGAGGAAGG + Intronic
977446529 4:97138674-97138696 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
977782536 4:100995862-100995884 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
977927445 4:102717320-102717342 CAGTGAGAGGTTGAGGAGGATGG + Intronic
978438521 4:108710689-108710711 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
979054715 4:115979702-115979724 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
979146525 4:117253752-117253774 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
979379845 4:119995584-119995606 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
979499041 4:121418269-121418291 CAGGGAAAGCCTGGGGCTGAAGG + Intergenic
979798391 4:124876064-124876086 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
979850398 4:125565684-125565706 AAGGAGCAGCCTGGGGAGGAAGG + Intergenic
980116366 4:128683161-128683183 CAGGGACGGTCTGAGGACAAAGG + Intergenic
980388830 4:132119865-132119887 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
980548332 4:134299568-134299590 CAGGGAGGGTCTGAGGAGGCTGG - Intergenic
980903844 4:138929535-138929557 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
982313185 4:154006361-154006383 CAGTGCCAGGCTAAGGAGGATGG + Intergenic
982318711 4:154057918-154057940 GAGGAGCAGCCTGAGGAGGAGGG - Intergenic
982396811 4:154922921-154922943 GAGCGGCAGCCTGGGGAGGAGGG + Intergenic
983069713 4:163254104-163254126 CAGGGACAGCCTGAAGGATAGGG - Intergenic
983360322 4:166717962-166717984 AAGGAGCAGCCTGGGGAGGAAGG - Intergenic
983414802 4:167439853-167439875 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
983447969 4:167877911-167877933 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
983883859 4:172960460-172960482 GAGGAGCAGCCTGGGGAGGAGGG + Intronic
984402349 4:179282494-179282516 CATTCACAGCCTGAGCAGGAAGG - Intergenic
984700574 4:182816184-182816206 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
985079101 4:186246216-186246238 AAGGAGCAGCCTGGGGAGGAGGG + Intronic
985371118 4:189285620-189285642 CAGGGACTGACTGGGGAGGCAGG + Intergenic
985389964 4:189483511-189483533 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
985530163 5:429425-429447 CTGGGACAGCCTGATGGGGCGGG + Intronic
985577848 5:681983-682005 CAGGGACAGCCTGTGGGGTTGGG - Intronic
985619140 5:944519-944541 CATAGACAGCATGAGGAGCATGG - Intergenic
985667764 5:1191108-1191130 CAGGGGCAGCCTGCAGAGGCAGG + Intergenic
985699094 5:1359531-1359553 ACAGGACCGCCTGAGGAGGAAGG - Intergenic
986068468 5:4259153-4259175 TCAGGACAGCCTGAGGAGAAAGG - Intergenic
987281949 5:16421668-16421690 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988683132 5:33502774-33502796 CACCGACGGCCTGGGGAGGAGGG + Intergenic
989659831 5:43787766-43787788 GAGAAGCAGCCTGAGGAGGAGGG - Intergenic
990530327 5:56667053-56667075 CAAGGACCGCCTCAGGAGAAGGG - Intergenic
990565219 5:57021065-57021087 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
990793772 5:59516275-59516297 AAGTGACTGCCTGGGGAGGAGGG - Intronic
991392867 5:66167157-66167179 CAGGGAAAGGCTGTGGGGGAGGG - Intronic
993192625 5:84700143-84700165 AAGGAGCAGCCTGGGGAGGAAGG - Intergenic
993305632 5:86271833-86271855 GAAGGACAGAATGAGGAGGAAGG - Intergenic
994126204 5:96170958-96170980 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
994216023 5:97138576-97138598 CAGAGACAGACTGAGGAGGCAGG - Intronic
994324727 5:98435874-98435896 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
994497794 5:100535577-100535599 CAGCAACAGCAGGAGGAGGACGG - Exonic
994989457 5:106980041-106980063 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
995332902 5:110965467-110965489 CAGGGACAGCCTAGGGCTGATGG + Intergenic
995899463 5:117050414-117050436 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
996241319 5:121206771-121206793 CAGGGACTACCAGAGGAGAAGGG + Intergenic
996358724 5:122622945-122622967 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
996790078 5:127282936-127282958 CAGGGACAGCCTGACCAGATTGG + Intergenic
997237076 5:132278818-132278840 CAGGGGCACCCAGAGGTGGAGGG - Intronic
997530100 5:134576739-134576761 CAGGGAAAGTGAGAGGAGGAGGG - Intronic
998160055 5:139808264-139808286 CAGGGGCAGACAGGGGAGGAGGG + Intronic
998172703 5:139881884-139881906 CAGGGAAACTCTGAGAAGGAAGG - Intronic
998231368 5:140363426-140363448 CGAGGGAAGCCTGAGGAGGAGGG - Exonic
998349237 5:141490213-141490235 CAGGGACAGCCTGCCATGGAGGG + Exonic
998720988 5:144948782-144948804 CATGGACAGAGAGAGGAGGAAGG + Intergenic
998995298 5:147864937-147864959 AAGGAGCAGCCTGGGGAGGAAGG - Intergenic
999133155 5:149299745-149299767 CAGGGGCTGCCGCAGGAGGAAGG + Intronic
999374039 5:151074306-151074328 CAGAGACAGACGCAGGAGGATGG + Intronic
999380357 5:151117161-151117183 CAGGGGCATCGTGAGGAGGGAGG - Exonic
1000462953 5:161545635-161545657 GTGGGAAAGACTGAGGAGGAGGG - Intronic
1000978596 5:167792343-167792365 CTGGGACAGCCTGAGGATGAAGG + Intronic
1001945106 5:175772196-175772218 CCTGGACAGCCTCAGGATGAGGG - Intergenic
1001953088 5:175829814-175829836 CAGGCACTGCCTGAGTAGTAAGG - Intronic
1001998368 5:176180323-176180345 GAGGTACAGGCTGAGGAGAAAGG - Intergenic
1002307443 5:178292181-178292203 CAGGAACAGATCGAGGAGGAGGG - Intronic
1002447439 5:179298021-179298043 CAGAGAGAGGCTGAGCAGGAGGG - Intronic
1002611056 5:180418774-180418796 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1002799043 6:503867-503889 ACGGGACAGGCTGAGGAGGAAGG - Intronic
1003277386 6:4664339-4664361 CAGTCACGGCCTGAGGAGGTGGG - Intergenic
1003430260 6:6031830-6031852 AAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1003479890 6:6521173-6521195 GAGGGAGAGGCTGAGGAGGGAGG - Intergenic
1004077566 6:12358365-12358387 CAGGGACAGACTGGGGAAGAAGG - Intergenic
1004283615 6:14300999-14301021 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1004508087 6:16263040-16263062 GAGGAGCAGCCTGGGGAGGAGGG + Intronic
1004575133 6:16887619-16887641 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1004698564 6:18057248-18057270 CAGGAACAGCAGGAGGGGGATGG - Intergenic
1004768670 6:18758113-18758135 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1005517266 6:26566715-26566737 CTGGGACTGGCTGAGGAGGGAGG - Intergenic
1005786675 6:29251291-29251313 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1006300978 6:33193378-33193400 CGGGGCCGGCCGGAGGAGGAAGG - Intergenic
1006313639 6:33278035-33278057 CAGAGAGAGGCTGAGCAGGAAGG + Exonic
1006815784 6:36848925-36848947 CAGGTACAGCCAGGGGAGGCAGG - Intergenic
1006931710 6:37692681-37692703 GAGGGACAGGCTGGGGGGGAAGG - Intronic
1007071902 6:39044004-39044026 AAGGGCCAGCCTGAGGGCGATGG + Intergenic
1007084691 6:39135083-39135105 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1007299753 6:40857932-40857954 CAAGGATAGCATGAAGAGGACGG - Intergenic
1007438462 6:41835871-41835893 CAAGATCAGCCTGAGGAAGATGG + Intronic
1007503408 6:42315857-42315879 CAGGCAGAGGCTGAAGAGGAGGG + Intronic
1007604331 6:43106103-43106125 GGGGGACAGCCTGAGCAGGGTGG + Intronic
1007665397 6:43510294-43510316 CAGAGAGAGCCTGAGGCGGGCGG + Exonic
1008105195 6:47433553-47433575 CAAGGCCAGCCTGGGGAAGATGG - Intergenic
1008476425 6:51939809-51939831 AAGGAGCAGCCTGGGGAGGAGGG - Intronic
1009269722 6:61601728-61601750 TAGGAACAGCCTGGGGAGGAGGG - Intergenic
1009343516 6:62587605-62587627 GAGGAGCAGCCTGGGGAGGATGG - Intergenic
1009404896 6:63300139-63300161 CAGGCAAAGCTGGAGGAGGAAGG - Intronic
1009750114 6:67871337-67871359 CTGGGGCAGTCTGGGGAGGAGGG - Intergenic
1009750399 6:67873024-67873046 CTGGGGCAGTCTGGGGAGGAGGG + Intergenic
1010071819 6:71752627-71752649 GAGGGGCAGCCTGGGGAGGAGGG + Intergenic
1010734724 6:79431154-79431176 CAGGAACAGCTTGAGGCTGAGGG - Intergenic
1010779891 6:79933429-79933451 CAGGGCCAGCCTGAGCAACATGG - Intronic
1010887608 6:81263515-81263537 CAGGGACAGCCTAAAGCGCAGGG - Intergenic
1011771036 6:90674260-90674282 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1012014481 6:93834126-93834148 GAGGATCAGCCTGGGGAGGAAGG + Intergenic
1012315731 6:97781258-97781280 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1013608526 6:111773360-111773382 GAGGGAGAGGCAGAGGAGGAGGG + Intronic
1013843773 6:114426372-114426394 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1014303373 6:119711264-119711286 CTGGCACAAGCTGAGGAGGAGGG - Intergenic
1014555753 6:122841497-122841519 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1014794083 6:125705910-125705932 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1015801469 6:137065386-137065408 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1016114237 6:140261456-140261478 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1016121553 6:140348363-140348385 CAGGGACAGGATGTGGAAGAGGG + Intergenic
1016248773 6:142017476-142017498 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1016469956 6:144364792-144364814 CATGGGCAGCCTGTGGAGGCTGG - Intronic
1016799603 6:148155462-148155484 CAGGGACAGGCTCAGGTTGAGGG + Intergenic
1016802814 6:148183670-148183692 CAGACACAGCAGGAGGAGGACGG + Intergenic
1016853174 6:148641461-148641483 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1017872595 6:158499774-158499796 CAGAGCCAAGCTGAGGAGGAGGG - Intronic
1018038198 6:159899366-159899388 CAGTGACAGCCTGGGGTGGAGGG - Intergenic
1018084594 6:160290619-160290641 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1018495494 6:164342787-164342809 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1018521567 6:164656200-164656222 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1019377253 7:699410-699432 CAGGAACAGCCGGGGTAGGAAGG + Intronic
1019485046 7:1285563-1285585 CAGGGACAACTGGGGGAGGAGGG - Intergenic
1019551774 7:1606761-1606783 GAGGGACAGGGAGAGGAGGAAGG - Intergenic
1019554825 7:1624026-1624048 CAGGGACTGAGTGAGGAGGAGGG - Intergenic
1019645245 7:2125375-2125397 TGGGGCCAGCATGAGGAGGAAGG - Intronic
1019712543 7:2524232-2524254 GAGGGACAGGCGGAGGAGGTCGG - Intronic
1019824191 7:3269981-3270003 CAAAGACGACCTGAGGAGGAAGG - Intergenic
1020011760 7:4809181-4809203 CAGTGACAGCCCGGGGAGGCGGG - Intronic
1020105313 7:5420030-5420052 CAGGGACAGCCCGGGAAGGAGGG + Intronic
1020315955 7:6905451-6905473 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1020794108 7:12661221-12661243 CAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1021043160 7:15888740-15888762 CAGTGACTGCCTCTGGAGGATGG - Intergenic
1021172572 7:17415430-17415452 GAGGAACAGTCTGGGGAGGAGGG - Intergenic
1021776360 7:24058907-24058929 CAGGCATAGCATGAGGAAGATGG + Intergenic
1021810571 7:24397938-24397960 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1022029482 7:26479269-26479291 CAGGGACAGCCTGCCCAGAACGG - Intergenic
1022447314 7:30480895-30480917 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1022708972 7:32834031-32834053 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1022795422 7:33727887-33727909 CAAGGAGAGCCTGAGGGGTAGGG - Exonic
1022848644 7:34237035-34237057 CAAGGAAAGCCTTGGGAGGATGG + Intergenic
1023968527 7:44975943-44975965 CAGCTGCAGCCTGGGGAGGAGGG + Intronic
1024112130 7:46158124-46158146 TAGGAACAGCCTTAGGCGGAGGG - Intergenic
1024251327 7:47507846-47507868 CAGGGACAGCTGTGGGAGGAGGG + Intronic
1024532858 7:50407520-50407542 CAGGCACAGAGTGAGGAGGTGGG + Intergenic
1024570867 7:50722034-50722056 CAAAGACAGGCTGAGGAGGCTGG + Intronic
1024697531 7:51871679-51871701 GAGGAACAACCTGGGGAGGAAGG - Intergenic
1024739352 7:52337703-52337725 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1024857045 7:53794533-53794555 CAGGGACAGCCTGAAGACTGGGG - Intergenic
1026254209 7:68696822-68696844 CAGTGACACCCTGAAGAGTAAGG - Intergenic
1026323070 7:69284317-69284339 CAGGGCCAGGCTGAGGTGGCGGG - Intergenic
1026562443 7:71461763-71461785 CAGGAAAAGGCAGAGGAGGAGGG - Intronic
1027851855 7:83461330-83461352 GAGGAGCAGCCTGGGGAGGAAGG - Intronic
1028079267 7:86553528-86553550 CATGGATAGCTTGATGAGGATGG - Intergenic
1028590007 7:92483869-92483891 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1028670422 7:93395598-93395620 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1029658271 7:101941932-101941954 CAGGGACAGAGAGAGGGGGAGGG - Intronic
1031422552 7:121568063-121568085 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1031525503 7:122818582-122818604 AAGGAGCAGCCTGGGGAGGAAGG - Intronic
1031685757 7:124730691-124730713 GATGAGCAGCCTGAGGAGGAGGG - Intergenic
1031728019 7:125262951-125262973 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1031776236 7:125911650-125911672 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1031960110 7:127981446-127981468 CAGAGACAGCCTGGTGAGGTGGG + Intronic
1032148386 7:129405084-129405106 TTGGTACAGCCTGAGGATGAGGG - Exonic
1032572564 7:133016005-133016027 CAAGAACAGCCTTAGGAGGATGG + Intronic
1032724705 7:134580127-134580149 CAGGAAAAGACTCAGGAGGAAGG - Intergenic
1033465135 7:141582871-141582893 GAGGAGCAGCCTGGGGAGGAGGG + Intronic
1033596775 7:142864596-142864618 CATGCAGAGCCAGAGGAGGATGG + Exonic
1033625485 7:143106477-143106499 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1033646747 7:143310809-143310831 CAGGGAAAGCCTGACGTGCAGGG + Intergenic
1033676045 7:143541270-143541292 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1033695790 7:143788169-143788191 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1034240332 7:149605876-149605898 CAGGGAAAGGCTAAGGAGGAAGG - Intergenic
1034721643 7:153299396-153299418 TGGGGACAGCCTGAGCAGCAGGG + Intergenic
1034960535 7:155361757-155361779 CAGAGACAGCCCACGGAGGAAGG + Intronic
1034990776 7:155546868-155546890 CAGCCACAGCCTGGGGAGAAGGG - Intergenic
1035122530 7:156580098-156580120 CAAGGACAGCCAGAGGATGGGGG + Intergenic
1035170589 7:157015283-157015305 CAGGGAGAGGCTGAGGAGGAGGG - Intergenic
1035618253 8:1018202-1018224 CAGGGACAAGCTGAGGACGGAGG - Intergenic
1035693764 8:1577836-1577858 CAGGGGCAGGTTGAGGAGGAAGG - Intronic
1036281389 8:7404100-7404122 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1036340078 8:7907472-7907494 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1036549567 8:9804595-9804617 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1036644100 8:10601419-10601441 TGGGGACACCCTGAGGAGGCAGG + Intergenic
1036779747 8:11637845-11637867 GAGGGAGACCCTGAAGAGGAAGG + Intergenic
1036905325 8:12703915-12703937 CAGGGACAGCCCAGCGAGGATGG + Intergenic
1037313082 8:17576830-17576852 CAGGTTCTGCCTGAGGAGGTGGG + Intronic
1037346806 8:17909706-17909728 CCTGCACAGCCTGAGAAGGAGGG - Intronic
1037917452 8:22781289-22781311 CCGGGAGAGCCGGAGGGGGAAGG + Intronic
1037952427 8:23027901-23027923 CAGAGACACCCTGAGGAAGGGGG + Intronic
1038357081 8:26839498-26839520 CAGGTACAGTCAGAGGAGGCTGG - Intronic
1039028086 8:33279979-33280001 CAAAGACAGCATGATGAGGATGG - Intergenic
1039499100 8:38002760-38002782 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1041651944 8:60310600-60310622 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1042052708 8:64728956-64728978 CAAGAACAGCCTGAGGAACATGG + Intronic
1042453461 8:68974834-68974856 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1042707272 8:71676574-71676596 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1045006668 8:97922100-97922122 CAGGGACAGAGTGGGGAAGAGGG - Intronic
1045197427 8:99945532-99945554 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1046074799 8:109302471-109302493 GAGGCACAGCCTGGGGAGGAGGG - Intronic
1046443160 8:114283654-114283676 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1046511991 8:115213888-115213910 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1047023338 8:120800539-120800561 CAAGGACAGCCCAAGGAGGATGG + Intronic
1047024988 8:120814486-120814508 GAGGGAGACACTGAGGAGGAAGG + Intergenic
1047782687 8:128123026-128123048 CAGGGAGAGAGGGAGGAGGAAGG - Intergenic
1047885106 8:129241454-129241476 CTGTGACAGTCTGAAGAGGAAGG + Intergenic
1048168532 8:132084286-132084308 GAGGAGCAGCCTGGGGAGGAAGG + Intronic
1048385540 8:133909227-133909249 CAGGGATGGGCTGGGGAGGAGGG + Intergenic
1048474921 8:134734309-134734331 TAGGAACAGCCTGAAGTGGAGGG - Intergenic
1048964210 8:139603690-139603712 GAGGGACACCCTGAGCAGGTTGG - Intronic
1049310463 8:141931322-141931344 AGGGGGCAGCCTAAGGAGGAGGG + Intergenic
1049622323 8:143604258-143604280 CAGGGTCAGCCTAAGGAGATGGG - Exonic
1049684151 8:143932601-143932623 CAGGGCCAGCCGGGGGAGGTGGG - Intronic
1049777272 8:144412562-144412584 CAGGGACAGCAGCAGCAGGACGG + Exonic
1049835786 8:144734616-144734638 CTGGGACACCCTGAAGAGGGAGG + Intronic
1049868911 8:144958341-144958363 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1050117504 9:2277219-2277241 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1051432007 9:16988797-16988819 CATAGGCAGCATGAGGAGGATGG + Intergenic
1052653236 9:31328041-31328063 AAGGGGTAGCCTGGGGAGGAGGG - Intergenic
1054663186 9:67716127-67716149 CAGGGACAGGGTGAGGAGCGTGG + Intergenic
1056323792 9:85460308-85460330 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1056522351 9:87412588-87412610 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1056640702 9:88368073-88368095 CAGGGGGAGGCTGAGGTGGAAGG + Intergenic
1056882887 9:90414237-90414259 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1057234750 9:93349267-93349289 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1057281329 9:93713751-93713773 CAGGGACAGGGTGAGAAGGAAGG - Intergenic
1057576242 9:96244984-96245006 TAAAAACAGCCTGAGGAGGAGGG - Intronic
1057683876 9:97216290-97216312 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1057706370 9:97397968-97397990 CAGAGGCAGCGAGAGGAGGAGGG - Intergenic
1057843994 9:98507837-98507859 CAGGGGCTGCCTGAGGAAGCAGG + Intronic
1057981989 9:99671827-99671849 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1059199671 9:112402578-112402600 CAAGGCCAGCCTGAGTAAGATGG + Intronic
1059546257 9:115178703-115178725 GAGGAGCAGCCTGGGGAGGAGGG + Intronic
1059606800 9:115843253-115843275 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1059863579 9:118489722-118489744 GAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1060223032 9:121774367-121774389 CAGGGATAGGCTAAGGAGTAAGG + Exonic
1060624703 9:125101105-125101127 CAGGCACAGATTGATGAGGAGGG + Intronic
1060755084 9:126206679-126206701 CAGGGAGAGCAAGAGAAGGAAGG - Intergenic
1060920178 9:127414948-127414970 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1060979356 9:127783855-127783877 GAAGGTCAGGCTGAGGAGGAAGG - Intergenic
1061137402 9:128742779-128742801 CAGGGTCAGACTCAGGAGCAGGG + Intronic
1061178710 9:129011906-129011928 CAGAGACAGCAGGAGGTGGAGGG + Intronic
1061237665 9:129351949-129351971 CAGAGACCGCCCGAGGGGGAAGG - Intergenic
1061371531 9:130200450-130200472 CAGGGACAGGCTGACAGGGAGGG + Intronic
1061860807 9:133467935-133467957 CAGGGTCAGGCTGATGACGATGG - Exonic
1062052298 9:134453940-134453962 CAGGGACATCCTTAGCTGGATGG + Intergenic
1062306333 9:135908725-135908747 CAAGGAAAGCCATAGGAGGAGGG + Intergenic
1185660854 X:1727792-1727814 CTGGGGCAGCCTGGGGAGGAGGG + Intergenic
1186112965 X:6276236-6276258 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1186194530 X:7097883-7097905 CTAAGTCAGCCTGAGGAGGAAGG + Intronic
1186411358 X:9347208-9347230 CAAGGAGAGCCTAAGGAGGCCGG - Intergenic
1186433101 X:9521322-9521344 CAGGGAAAGCCAGAGGTGGTGGG + Intronic
1186783971 X:12941455-12941477 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1187100057 X:16183234-16183256 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1188050415 X:25478536-25478558 GAGGGAGAGCAAGAGGAGGAAGG - Intergenic
1188301154 X:28506481-28506503 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1188333122 X:28896672-28896694 GAGGAGCAGCCTGGGGAGGAGGG + Intronic
1189192502 X:39122646-39122668 CAGAGAAAGCCTGAGAAGGGAGG + Intergenic
1189280774 X:39818940-39818962 CGGGAACAGCCTGGGGAGGGTGG + Intergenic
1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG + Intergenic
1190096187 X:47482910-47482932 TAGGGACGGCCTGAGGCCGAGGG - Exonic
1190708268 X:53048478-53048500 CAGGGGCGGGCGGAGGAGGAGGG - Intergenic
1190732734 X:53235709-53235731 CATGGAGACCCAGAGGAGGAGGG - Intronic
1191014295 X:55792359-55792381 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1191255306 X:58277090-58277112 CAGGGAAAGGTTGAGGAGGCCGG - Intergenic
1191629031 X:63300918-63300940 CACAGACAGCCTGAGGAGCAAGG - Intergenic
1192220089 X:69191946-69191968 CAGGCTCTGCCAGAGGAGGAAGG - Intergenic
1192454491 X:71265834-71265856 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1192566176 X:72165376-72165398 AAGGGGCAGCCAGAGGCGGACGG + Intergenic
1192731614 X:73806971-73806993 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1192914234 X:75636345-75636367 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1193885844 X:86983468-86983490 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1194351197 X:92826164-92826186 AAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1194503074 X:94702866-94702888 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1194895406 X:99433419-99433441 CAAGGACAGCATCAGGTGGATGG - Intergenic
1195017051 X:100790503-100790525 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1195275140 X:103274481-103274503 GAGGGAAAGCCAGAGGATGAGGG - Exonic
1195326959 X:103765851-103765873 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1195418548 X:104647203-104647225 CTGGGACAGCTGGAGGAGGCAGG + Intronic
1196072993 X:111545580-111545602 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1196165453 X:112532279-112532301 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1196330734 X:114468426-114468448 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1196341807 X:114605349-114605371 GAGGAGCAGCCTGGGGAGGAAGG + Intronic
1196496768 X:116332449-116332471 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1196585017 X:117419290-117419312 AAGGGGCAGCCTGGGGAGAAGGG - Intergenic
1196992783 X:121347063-121347085 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1197064820 X:122223698-122223720 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1197231859 X:124013994-124014016 CTGGGACAGCCTGAGTATGTAGG + Intronic
1197793548 X:130278691-130278713 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1198441117 X:136664148-136664170 AGGGGACAGCCTAAGGAGGCAGG + Intergenic
1198598361 X:138260448-138260470 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1199377717 X:147133182-147133204 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1200076633 X:153554503-153554525 CAGGGCCAGGCTGCGGAGGCTGG + Intronic
1200659523 Y:5942844-5942866 GAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1201473586 Y:14358502-14358524 GAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1201581301 Y:15514030-15514052 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1202061962 Y:20897866-20897888 GAGGAGCAGCCTGGGGAGGAGGG - Intergenic