ID: 1172221628

View in Genome Browser
Species Human (GRCh38)
Location 20:33278095-33278117
Sequence CACCTTCATCAACTGGACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172221624_1172221628 -2 Left 1172221624 20:33278074-33278096 CCTCTGTTGGGTCACCCAACACA 0: 1
1: 0
2: 0
3: 10
4: 93
Right 1172221628 20:33278095-33278117 CACCTTCATCAACTGGACTGTGG 0: 1
1: 0
2: 0
3: 12
4: 139
1172221619_1172221628 15 Left 1172221619 20:33278057-33278079 CCGGCTGCCTGCATCCACCTCTG 0: 1
1: 0
2: 4
3: 44
4: 488
Right 1172221628 20:33278095-33278117 CACCTTCATCAACTGGACTGTGG 0: 1
1: 0
2: 0
3: 12
4: 139
1172221618_1172221628 26 Left 1172221618 20:33278046-33278068 CCAGCACTCAGCCGGCTGCCTGC 0: 1
1: 0
2: 4
3: 28
4: 298
Right 1172221628 20:33278095-33278117 CACCTTCATCAACTGGACTGTGG 0: 1
1: 0
2: 0
3: 12
4: 139
1172221622_1172221628 8 Left 1172221622 20:33278064-33278086 CCTGCATCCACCTCTGTTGGGTC 0: 1
1: 0
2: 1
3: 15
4: 132
Right 1172221628 20:33278095-33278117 CACCTTCATCAACTGGACTGTGG 0: 1
1: 0
2: 0
3: 12
4: 139
1172221617_1172221628 27 Left 1172221617 20:33278045-33278067 CCCAGCACTCAGCCGGCTGCCTG 0: 1
1: 0
2: 3
3: 25
4: 305
Right 1172221628 20:33278095-33278117 CACCTTCATCAACTGGACTGTGG 0: 1
1: 0
2: 0
3: 12
4: 139
1172221623_1172221628 1 Left 1172221623 20:33278071-33278093 CCACCTCTGTTGGGTCACCCAAC 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1172221628 20:33278095-33278117 CACCTTCATCAACTGGACTGTGG 0: 1
1: 0
2: 0
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172221628 Original CRISPR CACCTTCATCAACTGGACTG TGG Intronic
901376062 1:8840441-8840463 CAACTCCATCAACTGGAAGGAGG - Intergenic
901510409 1:9715609-9715631 CACCTGCATCAACCAGACAGCGG + Exonic
903241641 1:21986659-21986681 CGCCTTCATTGACTGGATTGAGG + Exonic
903245148 1:22009833-22009855 CGCCTTCATCGACTGGATTGAGG + Exonic
905500564 1:38433250-38433272 CATCTTCACCAACTGTTCTGGGG - Intergenic
905527706 1:38651730-38651752 CCCCTTCATCAACTGGTCAGGGG - Intergenic
908520400 1:64935830-64935852 CAATTTCATCTAGTGGACTGTGG + Intronic
909675659 1:78236717-78236739 TACCTTCCTCAACTAGACTGTGG + Intergenic
912395891 1:109343739-109343761 CACAAGAATCAACTGGACTGTGG - Intronic
913102063 1:115577512-115577534 GACCTTTATCAAGAGGACTGTGG - Intergenic
913578272 1:120198993-120199015 CACTTACAGCAACTTGACTGAGG + Intergenic
913629902 1:120699365-120699387 CACTTACAGCAACTTGACTGAGG - Intergenic
914560190 1:148810407-148810429 CACTTACAGCAACTTGACTGAGG + Intronic
914612643 1:149319808-149319830 CACTTACAGCAACTTGACTGAGG - Intergenic
915458837 1:156057689-156057711 CACCCTCACCAACTGGGATGAGG + Intronic
919646357 1:200098767-200098789 CCCTTTCATTACCTGGACTGGGG - Intronic
921961228 1:221036559-221036581 CACCTACATCAAAGGGATTGAGG - Intergenic
1064429274 10:15257295-15257317 AACCTTCTCCGACTGGACTGAGG + Intronic
1065686190 10:28287392-28287414 CACGTTTATCACCTGGATTGTGG + Intronic
1066992831 10:42532220-42532242 CATCTTAGTCAACTGGACTGAGG - Intergenic
1067343298 10:45421034-45421056 CACCTTGATCACCTGGCCTAGGG - Intronic
1068960858 10:62865004-62865026 CACCTACATCAACACCACTGTGG + Intronic
1069232757 10:66032483-66032505 TAGCTTCAACCACTGGACTGTGG - Intronic
1069488736 10:68843364-68843386 AACATTCATCAACAGGTCTGTGG + Intronic
1076122256 10:127945540-127945562 CACCTTCCTCTACAGGAATGGGG + Intronic
1079011064 11:16828722-16828744 CACCTGAACCACCTGGACTGAGG - Intronic
1083611574 11:64006943-64006965 CACCATCATCAACTGGGGTCAGG + Intronic
1085424660 11:76393398-76393420 CACCTACTGCAACTGGACAGGGG + Intronic
1086297559 11:85387942-85387964 CACCTCCTTCAAATGGTCTGTGG - Intronic
1089159809 11:116428733-116428755 CATCTTCAGAAACTGGAGTGGGG - Intergenic
1091163224 11:133445458-133445480 CTGCCTCATCAACTGGAGTGGGG + Intronic
1091982171 12:4874804-4874826 AACCTTCATCAGCAGGCCTGGGG + Intergenic
1093307468 12:17538472-17538494 CACCTTTATCGATTGGATTGAGG - Intergenic
1098703702 12:73661150-73661172 CACCTTCAGCTACTGGCATGTGG + Intergenic
1102792511 12:115659020-115659042 CAGCTTCCTCATCTAGACTGTGG + Intergenic
1106299609 13:28451744-28451766 CAGCTTCCTCATCTGGAATGTGG + Intronic
1112242795 13:97698681-97698703 CAACTTTAGCAACTAGACTGTGG - Intergenic
1113929073 13:113956970-113956992 CCCTTTCATCAAGTGCACTGGGG + Intergenic
1113929084 13:113957020-113957042 CCCGTTCATCAAGTGCACTGGGG + Intergenic
1113929180 13:113957410-113957432 CCCTTTCATCAAGTGCACTGGGG + Intergenic
1113929306 13:113957941-113957963 CCCTTTCATCAAGTGCACTGGGG + Intergenic
1113929370 13:113958186-113958208 CCCTTTCATCAAGTGCACTGGGG + Intergenic
1113929382 13:113958234-113958256 CCCTTTCATCAAGTGCACTGGGG + Intergenic
1119926127 14:78495755-78495777 CACCTTCACTAACTGGTATGTGG - Intronic
1120037134 14:79710610-79710632 TGCCCTCATAAACTGGACTGTGG - Intronic
1121442947 14:93960102-93960124 CTCCTTCACCAAGTGGACTGGGG - Intronic
1124125529 15:26935610-26935632 CACTTTCCTCAATCGGACTGGGG - Intronic
1131296170 15:91151033-91151055 CACCTAAATCATCTTGACTGAGG - Intronic
1132615130 16:837065-837087 CACCATGCTCAACTGGACTGTGG - Intergenic
1133922547 16:10166535-10166557 CAGCTTCATCCACAGGTCTGAGG - Intronic
1134464349 16:14460956-14460978 AACCTTCATCACCTGGGTTGAGG - Intronic
1135926858 16:26702306-26702328 CACCACCATCCATTGGACTGTGG + Intergenic
1136617999 16:31410472-31410494 CACCTTCATCAACATGTCTCAGG + Exonic
1139644227 16:68316336-68316358 CAACTTCATCAACACTACTGAGG - Intronic
1141746018 16:85926725-85926747 CAGCTGCATAAACTGGAATGGGG + Intergenic
1143388145 17:6544118-6544140 CACCTGCACCTACTGGCCTGTGG + Intronic
1146048170 17:29527748-29527770 CACATTCATTTACTGCACTGAGG - Intronic
1147157603 17:38552116-38552138 CACCCTCATCCACTTGCCTGGGG + Exonic
1151755232 17:76071966-76071988 CACCTTGAGCCACTGAACTGGGG - Intronic
1161405832 19:4090681-4090703 CACCTTCATCAAGCGGTCCGAGG - Exonic
1162540212 19:11291077-11291099 CACCTGCATGCACTGGTCTGGGG + Intergenic
1164028652 19:21380054-21380076 GAACTTTAGCAACTGGACTGAGG + Intergenic
1165443537 19:35844307-35844329 CACTTCCCTCACCTGGACTGAGG + Exonic
1165444455 19:35849233-35849255 CACCTTCAGCCACTGCAGTGTGG + Exonic
1166190442 19:41173118-41173140 CTGCCTCCTCAACTGGACTGTGG + Intergenic
1168527906 19:57103472-57103494 CACCGTCATCTCCTGCACTGCGG + Intergenic
1168564965 19:57415108-57415130 CACCAACCTCCACTGGACTGTGG - Intronic
926980052 2:18559648-18559670 CACCATCCTTAACGGGACTGTGG - Intronic
929197063 2:39195986-39196008 CACCTTCTTCAAAGGGTCTGTGG - Intronic
932322102 2:70829847-70829869 CAGCTTCAGCCACTGGACTTGGG + Intergenic
938175670 2:129125684-129125706 CACTTTCATCAAAGGGTCTGTGG + Intergenic
939972802 2:148681141-148681163 CTCCTTCTTCCACTGGACTGTGG - Intronic
940268664 2:151867618-151867640 CACATTCATCTACTGGACAAAGG - Intronic
944362697 2:198877012-198877034 CTCCGTCATCAGATGGACTGTGG - Intergenic
944429526 2:199617919-199617941 CACCTTCACCTTCAGGACTGAGG - Intergenic
945375327 2:209073232-209073254 CACCTTCATAAACTTGAATGAGG + Intergenic
945616319 2:212072952-212072974 CAACAACAACAACTGGACTGAGG + Intronic
946002569 2:216495062-216495084 GACCTTCATCACCTTGGCTGAGG + Intergenic
1170016645 20:11789338-11789360 CACCCTTATCAACTGTACTTTGG + Intergenic
1171493055 20:25535539-25535561 TACCTTCATAAACTGGGGTGGGG + Intronic
1172221628 20:33278095-33278117 CACCTTCATCAACTGGACTGTGG + Intronic
1174743841 20:53041670-53041692 CACCTTCTTCATCTGCAGTGTGG - Intronic
1180259251 21:46656744-46656766 AATCTTCATCACCTGGACTTGGG + Intronic
1181132644 22:20742319-20742341 CTCCTTCATCATCTGTGCTGGGG - Exonic
1182281244 22:29218830-29218852 CACTTTCATCATCCGGACAGTGG - Intronic
1182822776 22:33232969-33232991 CCCATTCATCATCTGGCCTGGGG + Intronic
1184691164 22:46117966-46117988 CACATTCATGAAATGGGCTGAGG - Intergenic
1185013767 22:48331812-48331834 CACCTTCCTCACCTGGAGTCCGG + Intergenic
949390543 3:3557654-3557676 CACCTTCATCAACTACAGAGTGG + Intergenic
950943186 3:16915694-16915716 CAAATTCATCAACTGAACTATGG + Intronic
955426319 3:58795229-58795251 TACCTTCTTTAACTGGATTGTGG + Intronic
960400502 3:117191865-117191887 CACATTCATGAAATGGACTGGGG + Intergenic
962388359 3:134951469-134951491 CACCTTCATCAACCGGCGGGGGG + Exonic
964667615 3:159191289-159191311 CATCTTCATCATCTTAACTGAGG - Intronic
965338449 3:167456744-167456766 GACCTTCATCAAATTGATTGAGG + Intronic
969062584 4:4449647-4449669 CACCTTCATCAAGTGGGCAAAGG - Intronic
969511407 4:7620081-7620103 CTCCTTCATCTGCTGGGCTGGGG + Intronic
969980993 4:11154334-11154356 CACCTTCTTCACCTGATCTGGGG + Intergenic
972296213 4:37741627-37741649 CATCTTCATCCACTAGAGTGCGG + Intergenic
974634838 4:64548148-64548170 CATTTTCATCATCTTGACTGGGG - Intergenic
976955639 4:90895636-90895658 TACCTTCTTCAACTGGGCTAGGG - Intronic
978536305 4:109766919-109766941 CACCATCCTCATCTGTACTGTGG - Intronic
979801141 4:124910530-124910552 CACCTTGATCTTCTGGACTCAGG + Intergenic
980637786 4:135531308-135531330 AACCTTGATAAGCTGGACTGAGG - Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991733513 5:69611107-69611129 CACATCCATCAACTGGGTTGAGG + Intergenic
991809947 5:70466253-70466275 CACATCCATCAACTGGGTTGAGG + Intergenic
991861441 5:71016743-71016765 CACATCCATCAACTGGGTTGAGG - Intronic
992599828 5:78388061-78388083 CACCTTCTTCAAAGGGTCTGTGG + Intronic
993170218 5:84410058-84410080 CTCCTTAATCAACCTGACTGTGG + Intergenic
993733176 5:91446299-91446321 CACCTTCACTAACTGGATAGAGG - Intergenic
996387871 5:122927900-122927922 CATCTGCATCAACTAGTCTGTGG - Intronic
997175859 5:131776866-131776888 CACTTTCAGAAACTGTACTGAGG + Intronic
998735343 5:145132111-145132133 CAACTGCACCAACTAGACTGTGG - Intergenic
1006305059 6:33213738-33213760 CACCTGCATCTACGGGATTGAGG - Intergenic
1014222725 6:118814775-118814797 CACCTTCTTCAACTCCACAGAGG - Exonic
1016596299 6:145805322-145805344 CACCTTCATCATCTGGCATGAGG + Exonic
1018601383 6:165546623-165546645 CAACTTTATCAACTAGAGTGTGG - Intronic
1018928742 6:168225630-168225652 CACCTTCAACAACAGAAGTGGGG - Intergenic
1019118849 6:169787159-169787181 CCCCTTCATCACCTAGGCTGAGG + Intergenic
1019596996 7:1862842-1862864 AACCCTCATCTACTGGTCTGAGG + Intronic
1021472410 7:21019986-21020008 CACATTCAACCACAGGACTGTGG - Intergenic
1023746469 7:43326949-43326971 CACCTTAACCATCTGGACTGTGG - Intronic
1024235795 7:47396797-47396819 CACCTTCTCCATCTGCACTGAGG + Exonic
1024991628 7:55239141-55239163 CTCCTTGACCAAGTGGACTGAGG - Intronic
1032270019 7:130396282-130396304 CACCTTCAACAACTGGATCATGG - Exonic
1033037040 7:137884813-137884835 GCCCCTCATCCACTGGACTGCGG - Intronic
1034752869 7:153587291-153587313 GACTTTCATCAACTGTACTTTGG - Intergenic
1035336052 7:158127533-158127555 CACCTTCTCCAACAGCACTGTGG + Intronic
1036422500 8:8611486-8611508 CTCCTTCATCAACTGTGCTCAGG - Intergenic
1038318923 8:26511250-26511272 CATCTTCATCAATTCGAATGGGG + Intronic
1038853326 8:31302198-31302220 CACCCTCATCATCTTCACTGAGG - Intergenic
1039631634 8:39118852-39118874 AACATTCTACAACTGGACTGTGG - Intronic
1040759844 8:50826845-50826867 CACCTTCATCACCTCACCTGTGG - Intergenic
1042655620 8:71092131-71092153 CATCTTCATCTATTAGACTGTGG - Intergenic
1046511457 8:115209616-115209638 CATCTTCAGCAACTGTACTTTGG + Intergenic
1047199598 8:122753911-122753933 CACCTGCACCAACTCGCCTGTGG + Intergenic
1047662819 8:127056707-127056729 CAACTGCATCAACAGGAGTGGGG - Intergenic
1049556121 8:143283110-143283132 GACCTGCATCAACTGGGCAGGGG - Intergenic
1055642137 9:78327513-78327535 CACCTTCCTCATCTGAACAGTGG - Intronic
1055716061 9:79119641-79119663 CACCTTAATCTACTGGAAGGTGG + Intergenic
1057068592 9:92076815-92076837 CACCTTCATCAGATGGGTTGAGG + Intronic
1057326933 9:94074277-94074299 CCACTTCGTCATCTGGACTGAGG - Intronic
1185687082 X:1938137-1938159 CACCATCACTAACTGGACAGAGG + Intergenic
1190377078 X:49798543-49798565 CACCTGCACTACCTGGACTGGGG - Intergenic
1191905322 X:66081875-66081897 CACATCCATCAACTGAACAGAGG - Intergenic
1191917196 X:66215736-66215758 CACCTCCATCAAAGGGTCTGTGG - Intronic
1199230226 X:145428557-145428579 CACTTTGATAAACTGGACTGCGG + Intergenic
1201667844 Y:16479006-16479028 GACCTTGATCACCTGGTCTGAGG - Intergenic
1202243966 Y:22797299-22797321 CACCTTCACCAAGTGAATTGAGG - Intergenic
1202396954 Y:24431049-24431071 CACCTTCACCAAGTGAATTGAGG - Intergenic
1202473829 Y:25239043-25239065 CACCTTCACCAAGTGAATTGAGG + Intergenic