ID: 1172222210

View in Genome Browser
Species Human (GRCh38)
Location 20:33281741-33281763
Sequence AGCTTTGCTGTCCCAGCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172222207_1172222210 1 Left 1172222207 20:33281717-33281739 CCATGGGCCTGCAGAGATGCAGC 0: 1
1: 0
2: 1
3: 31
4: 287
Right 1172222210 20:33281741-33281763 AGCTTTGCTGTCCCAGCACGTGG 0: 1
1: 0
2: 2
3: 8
4: 111
1172222208_1172222210 -6 Left 1172222208 20:33281724-33281746 CCTGCAGAGATGCAGCCAGCTTT 0: 1
1: 0
2: 1
3: 25
4: 219
Right 1172222210 20:33281741-33281763 AGCTTTGCTGTCCCAGCACGTGG 0: 1
1: 0
2: 2
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172222210 Original CRISPR AGCTTTGCTGTCCCAGCACG TGG Intronic
900131433 1:1088909-1088931 AGCTGCGCTCTCCCAGCACTGGG + Intronic
902373457 1:16019102-16019124 AGCTTTGCTGAGCAAGCAGGTGG - Intronic
902450169 1:16491597-16491619 ATCTTTGCTGGCCCAGAACGGGG + Intergenic
905474199 1:38214332-38214354 AGCTTTGCTGTCCCTGCAGGAGG + Intergenic
907494007 1:54830113-54830135 AGCTTGGCTGTCCAAGCTCTAGG + Intronic
909052231 1:70779986-70780008 ATATTTTCTGACCCAGCACGGGG - Intergenic
912431480 1:109630511-109630533 AGCTATGCTCTACCAGCAGGGGG - Intronic
1067440540 10:46306962-46306984 ATATGTGCTGTCCCAGCAGGGGG - Intronic
1068942956 10:62698442-62698464 TTCTTTGCTGTCCTGGCACGGGG - Intergenic
1070757198 10:79000783-79000805 AGCTTAGGTGTCCCAGCTCCAGG + Intergenic
1075946230 10:126435618-126435640 AGCTTTGCTTCCCCAGCTGGAGG + Intronic
1076522442 10:131089539-131089561 AGCTTGGCTCACCCATCACGTGG - Intergenic
1080645452 11:34184654-34184676 AGCATGGCTGCCCCAGCACAAGG + Intronic
1080802463 11:35620196-35620218 TTCTTTACTGTGCCAGCACGGGG + Exonic
1083624063 11:64062955-64062977 AGCTGTGTTGTCCCAGCCCCAGG - Intronic
1084319370 11:68365020-68365042 AGCTTGGCCATCCCAGCAAGAGG + Intronic
1084545812 11:69814586-69814608 AGGAGTGCTGTCCCACCACGGGG - Intronic
1086587529 11:88472659-88472681 AGCTTTGCAGGCTCAGCACAAGG - Intergenic
1087269850 11:96100086-96100108 AGCTTTGCAGTCCCATCAGGAGG - Intronic
1088871894 11:113897434-113897456 AGTCTTGCTGTGCCAGCACTGGG - Intergenic
1091410696 12:237347-237369 AGCTCCACTGTCCCAGGACGGGG - Intronic
1091561321 12:1616203-1616225 GTCTATGCTGCCCCAGCACGGGG - Intronic
1105212010 13:18262436-18262458 GGTTTTGCTGTCCCAGGATGAGG + Intergenic
1113239172 13:108316994-108317016 AGCTTTCCTTTCCTAGAACGTGG - Intergenic
1115701435 14:35956981-35957003 AGCTGTGCTGCCCCACCACAGGG - Intergenic
1115955571 14:38775294-38775316 AGCATTTCTGTCTCAGCAAGTGG + Intergenic
1119322409 14:73739732-73739754 AGCCATGCTGTCCCAGCAGGTGG - Exonic
1120962622 14:90139382-90139404 AGCTATGCTGGCCCACCACAGGG - Intronic
1127723640 15:61726482-61726504 AGCTTTGTTGTCCCGGAACAAGG + Intergenic
1128095930 15:64955503-64955525 GGCTTGGCTGTACCAGCAGGGGG + Intronic
1128924020 15:71637497-71637519 AGCTTCACTTTCCCTGCACGTGG - Intronic
1130956675 15:88631767-88631789 GGCTTGGCTGTTCCAGCAGGTGG + Exonic
1131635777 15:94231632-94231654 AGCTTTGCAGCCCCCGAACGCGG + Intronic
1136632182 16:31495420-31495442 AGCTTTGCTGTCACTGGATGTGG - Intronic
1138283404 16:55789778-55789800 AGCTCTCCTGTCCCAGCCCCAGG - Intergenic
1138285597 16:55807209-55807231 AGCTCTCCTGTCCCAGCCCCAGG + Intronic
1139532207 16:67547904-67547926 AGCTTGGCTTCCCCAGCAGGTGG - Intergenic
1143119829 17:4599740-4599762 GGCTGTGCTTCCCCAGCACGAGG + Intronic
1144735466 17:17553099-17553121 GGCTTTGCTGTCCCCACACACGG + Intronic
1148351286 17:46943667-46943689 AGCTTTGCTGGCCCTGCATGGGG - Intronic
1150584754 17:66507390-66507412 AGCTTTGCTGTTCAGTCACGTGG - Intronic
1151271279 17:72998051-72998073 AGTTTTGCTGTTGCACCACGGGG + Intronic
1152881431 17:82818295-82818317 AGCTGTGCTGTCTCTGCACAGGG + Intronic
1153762836 18:8348327-8348349 ACCTTTCCTGTCGCAGCACCTGG + Intronic
1153822621 18:8845158-8845180 AGCTTTCCTCTCACTGCACGTGG - Intergenic
1157264814 18:46209347-46209369 AGCTTTGCTGACCAAGAAGGAGG + Intronic
1160778144 19:866139-866161 AGCTCTGCTGTCCCCGCCCCCGG - Intergenic
1162259230 19:9518876-9518898 GGCTCTGCTGTCCCTGCACGTGG + Intergenic
1166141557 19:40808030-40808052 ACCTTTGCTGCCCCATCATGGGG + Exonic
1166233492 19:41439737-41439759 AGGTTTGCACTCCCAGTACGGGG + Intronic
925620906 2:5791715-5791737 ATCATTGCTGTCCCTGCAGGAGG - Intergenic
926172338 2:10560313-10560335 TGCATTGCTGTCCCAGCCCATGG - Intergenic
926234422 2:11028589-11028611 TGCTCTGCTCTCCCAGCAGGTGG - Intergenic
926328428 2:11805225-11805247 ATCTTTCCTGTCCCAGCACGGGG + Intronic
930957198 2:57217209-57217231 AGCTTGGCTGTGACAGCACCTGG - Intergenic
932298189 2:70643925-70643947 AGCCTTGCTGTCCTGCCACGAGG - Intronic
934301616 2:91779972-91779994 GGTTTTGCTGTCCCAGGATGAGG - Intergenic
935121846 2:100189966-100189988 AGCAGTGCTGTCCCAACAGGTGG + Intergenic
936238659 2:110768276-110768298 AGCTTTTCTGTCTGAGCCCGGGG + Intronic
937251388 2:120526061-120526083 AGCTTTGCTGCCCCACCCAGGGG + Intergenic
938159511 2:128972930-128972952 CACTTTGCTGTCCCTGCATGAGG + Intergenic
939057765 2:137384092-137384114 AGCTTTGCTCTCCAGGCATGTGG + Intronic
940366425 2:152853192-152853214 AGCTTTGTTTTCTCAGCTCGAGG - Intergenic
946169969 2:217889306-217889328 AACTGTGCTGTCCCAGCTGGGGG - Intronic
1169431929 20:5544134-5544156 AGGTGTGCTGTCCCAGGAAGAGG + Intergenic
1171390700 20:24799915-24799937 AGCTATTCTGTCCCAGTATGTGG - Intergenic
1172222210 20:33281741-33281763 AGCTTTGCTGTCCCAGCACGTGG + Intronic
1175205572 20:57308683-57308705 AGCTTAGCTGACTCAGCAAGGGG + Intergenic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1179995379 21:44971640-44971662 AGGTCTCCTGACCCAGCACGTGG + Intronic
1180152706 21:45959883-45959905 ACCTGTGCTGTAGCAGCACGCGG + Intergenic
1180814823 22:18782750-18782772 GGTTTTGCTGTCCCAGGATGAGG + Intergenic
1181201009 22:21217086-21217108 GGTTTTGCTGTCCCAGGATGAGG + Intronic
1181700731 22:24619884-24619906 GGTTTTGCTGTCCCAGGATGAGG - Intronic
1183836137 22:40455059-40455081 ACATTTGCAGTCCCAGCACATGG - Intronic
1203225908 22_KI270731v1_random:78342-78364 GGTTTTGCTGTCCCAGGATGAGG - Intergenic
1203264919 22_KI270734v1_random:8441-8463 GGTTTTGCTGTCCCAGGATGAGG + Intergenic
951211723 3:19982586-19982608 ATGCTTGCAGTCCCAGCACGTGG + Intronic
953054063 3:39373454-39373476 AGCTTTGCTGTCCCACTGCCTGG + Intergenic
953350403 3:42211013-42211035 AGCTTTGCCTTCCCAACACAAGG - Intronic
962355794 3:134693337-134693359 AGCTTTGCTGTCCTATCTCCAGG - Intronic
963604810 3:147405156-147405178 AGCTTGGGTTTCCCAGCTCGGGG + Intronic
964679535 3:159322445-159322467 AGCTCTGCTGTCAGAGTACGAGG + Intronic
968902565 4:3438449-3438471 GGCTGGGCTCTCCCAGCACGGGG + Intronic
969125761 4:4946657-4946679 ATCTTTGCTCTGCCACCACGAGG - Intergenic
969409634 4:7019665-7019687 AGTCTTTCTGTCCCAGCACTTGG - Intronic
972604241 4:40599556-40599578 AGCTTTGCTGTCCTATCTCTTGG + Intronic
973755490 4:54069437-54069459 TGCTCTGCTTTCCCAGCACACGG + Intronic
981028683 4:140101828-140101850 TGCTCAGCTGACCCAGCACGTGG - Intronic
983533085 4:168831850-168831872 AGCTTGGCTGCCCCAGGAAGGGG + Intronic
988678303 5:33457264-33457286 TGCTTTGCCTTCCCAGTACGTGG - Exonic
993792361 5:92223303-92223325 AGCTTAGCTGTTCCAGCATGTGG - Intergenic
995350121 5:111165212-111165234 AGCTTAGATGTCACAGCAGGAGG - Intergenic
995632749 5:114151410-114151432 CCCTTTGCTGTCCCACCAAGTGG - Intergenic
995868527 5:116719471-116719493 AGCTTAGCTATCCCAGCAGAAGG + Intergenic
1008920889 6:56843536-56843558 CGCTCTGCTGGCCCTGCACGAGG + Intronic
1010277964 6:73990919-73990941 GGCTCTGCTGGCCCAGCACTGGG - Intergenic
1013285711 6:108679694-108679716 AGCTTTGCTGTGCTAGCCCTGGG + Intronic
1018816508 6:167336670-167336692 AGCTGTCCTGTTCCAGAACGGGG + Intronic
1019189854 6:170245599-170245621 GGCTTTGCTGTCACAAAACGTGG + Intergenic
1019266390 7:119645-119667 AGCTGTACAGCCCCAGCACGGGG + Intergenic
1025994386 7:66518826-66518848 AGGTCTGTTGTCCCAGCACCAGG + Intergenic
1026985998 7:74555515-74555537 AGGTCTGTTGTCCCAGCACCAGG + Intronic
1030530201 7:110702535-110702557 AGCTTTGCTATCCAAGAACACGG + Intronic
1034254871 7:149719474-149719496 AGCCTAGCTGTCCCTGCACTTGG - Intronic
1034451460 7:151139284-151139306 AGCTGGGCGGTGCCAGCACGGGG + Intronic
1035458461 7:159024382-159024404 AGCTGTGCTGTCCCTGAAGGTGG + Intergenic
1037785288 8:21899380-21899402 GGCTTGGCTGGCCCAGCACAGGG - Intergenic
1043014259 8:74919010-74919032 AACTTTTCTGTCCCAGGACCAGG - Intergenic
1046630466 8:116618216-116618238 AGCTATGCTGGCCCAGCAAGAGG - Intergenic
1047406106 8:124587009-124587031 AGCTTTGCTGTACCAGCAAAGGG + Intronic
1048160117 8:132011336-132011358 AGTTTTGCAGTCCCAGGACTAGG - Exonic
1049624265 8:143613066-143613088 AGCTTTGGTGTCCCACCTCCAGG + Intronic
1054799138 9:69329736-69329758 AGCTGTGCTGTCCTAGCTCTCGG + Intronic
1057781786 9:98056522-98056544 AGGCTTGCTGTCCCAGAGCGTGG - Intergenic
1059668859 9:116474804-116474826 AGCTTTGCTGTCCATCCACCTGG - Intronic
1062336759 9:136074603-136074625 AGCCTTGCTGTGACAGAACGAGG - Intronic
1186417910 X:9399606-9399628 AGCTATGCTGTCACAGGCCGAGG + Intergenic
1192672656 X:73161929-73161951 AAATTTGCTGTTCCAGCAGGAGG + Intergenic
1198267528 X:135022788-135022810 GGCTTTGCTCTCCAAGCACATGG - Intergenic
1199448491 X:147953981-147954003 AGCTTTGCTGGCCAAGCAGTGGG - Intergenic
1200057927 X:153471096-153471118 AGCGTTCCTCTCCCAGCGCGGGG + Intronic