ID: 1172222406

View in Genome Browser
Species Human (GRCh38)
Location 20:33283047-33283069
Sequence CTTGGGACTCCAGCTTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 282}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172222406_1172222411 -7 Left 1172222406 20:33283047-33283069 CCTCAGGAAGCTGGAGTCCCAAG 0: 1
1: 0
2: 1
3: 25
4: 282
Right 1172222411 20:33283063-33283085 TCCCAAGGCTGCCTCCGGGCGGG 0: 1
1: 0
2: 1
3: 27
4: 212
1172222406_1172222413 -6 Left 1172222406 20:33283047-33283069 CCTCAGGAAGCTGGAGTCCCAAG 0: 1
1: 0
2: 1
3: 25
4: 282
Right 1172222413 20:33283064-33283086 CCCAAGGCTGCCTCCGGGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 184
1172222406_1172222410 -8 Left 1172222406 20:33283047-33283069 CCTCAGGAAGCTGGAGTCCCAAG 0: 1
1: 0
2: 1
3: 25
4: 282
Right 1172222410 20:33283062-33283084 GTCCCAAGGCTGCCTCCGGGCGG 0: 1
1: 0
2: 1
3: 16
4: 165
1172222406_1172222418 30 Left 1172222406 20:33283047-33283069 CCTCAGGAAGCTGGAGTCCCAAG 0: 1
1: 0
2: 1
3: 25
4: 282
Right 1172222418 20:33283100-33283122 GAAGCCACAAATATTTACCTTGG 0: 1
1: 0
2: 0
3: 10
4: 203
1172222406_1172222415 0 Left 1172222406 20:33283047-33283069 CCTCAGGAAGCTGGAGTCCCAAG 0: 1
1: 0
2: 1
3: 25
4: 282
Right 1172222415 20:33283070-33283092 GCTGCCTCCGGGCGGGGCTGTGG 0: 1
1: 1
2: 7
3: 48
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172222406 Original CRISPR CTTGGGACTCCAGCTTCCTG AGG (reversed) Intronic