ID: 1172222412

View in Genome Browser
Species Human (GRCh38)
Location 20:33283064-33283086
Sequence CCCCGCCCGGAGGCAGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172222412_1172222421 27 Left 1172222412 20:33283064-33283086 CCCAAGGCTGCCTCCGGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1172222421 20:33283114-33283136 TTACCTTGGAGACCTCGGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 98
1172222412_1172222418 13 Left 1172222412 20:33283064-33283086 CCCAAGGCTGCCTCCGGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1172222418 20:33283100-33283122 GAAGCCACAAATATTTACCTTGG 0: 1
1: 0
2: 0
3: 10
4: 203
1172222412_1172222420 22 Left 1172222412 20:33283064-33283086 CCCAAGGCTGCCTCCGGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1172222420 20:33283109-33283131 AATATTTACCTTGGAGACCTCGG 0: 1
1: 0
2: 1
3: 19
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172222412 Original CRISPR CCCCGCCCGGAGGCAGCCTT GGG (reversed) Intronic
900357111 1:2270337-2270359 CCACGGCCTGAGGCAGCCGTTGG + Intronic
900401059 1:2473151-2473173 ACCCGCCCGGTTCCAGCCTTGGG + Intronic
900606832 1:3527479-3527501 CCCCTCTGGGAGGCAGCCTCAGG - Intronic
902292671 1:15445540-15445562 CCCCCCCCAGAGGAAGTCTTGGG - Intronic
902821793 1:18947898-18947920 CCTCACCCTGAGCCAGCCTTTGG + Intronic
902843698 1:19092842-19092864 CCAGGCCCCGAAGCAGCCTTAGG + Exonic
904081102 1:27872972-27872994 CCGCGCCGGGACGCAGCATTAGG + Intronic
904260236 1:29283789-29283811 CCCCACCCGAAGGCAGGCCTGGG - Intronic
905028556 1:34866802-34866824 CCCCGCGCTGAGGAAGCCTTGGG + Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
907424055 1:54367659-54367681 CCCGCCGCAGAGGCAGCCTTTGG - Intronic
911027416 1:93448959-93448981 CCACCCCCGGCTGCAGCCTTTGG + Intronic
914703079 1:150150791-150150813 CGCCCCCCGGCCGCAGCCTTCGG + Intronic
915446980 1:155979433-155979455 CCCCAGCCTGAGCCAGCCTTTGG + Intronic
920174914 1:204094653-204094675 GCCCGCCCCAAGGGAGCCTTGGG - Intronic
920271662 1:204769547-204769569 CCCCACCTCCAGGCAGCCTTGGG + Intergenic
922315036 1:224434578-224434600 CCCCTCCCGGAGGCAGCTCGGGG + Intronic
924432995 1:244013225-244013247 CCCAGCCCAAAGGCAGCTTTTGG - Intergenic
1064260062 10:13778161-13778183 CTCCACCAGGTGGCAGCCTTGGG - Intronic
1066460382 10:35607964-35607986 ACCCTGCTGGAGGCAGCCTTCGG + Exonic
1069599034 10:69691514-69691536 CCAGGCCCAGAGGCACCCTTGGG - Intronic
1070800907 10:79243787-79243809 CCGCGCCCGGAGGGAGCCCAGGG - Intronic
1073305984 10:102503948-102503970 CGCCGCCCCGAGGCACCCTCTGG + Intergenic
1074130420 10:110568258-110568280 CCCGGCCCGGGGGCGGCCCTGGG + Intronic
1076713969 10:132354013-132354035 CCCTGCCAGGAGGCTGCCTGTGG + Intronic
1076933749 10:133553531-133553553 CCCTTCACTGAGGCAGCCTTTGG + Intronic
1077097448 11:805063-805085 CCCAGCCCCGAGGCAGGCTCGGG + Intronic
1077372788 11:2191308-2191330 CCCCTCCCTGAGACAGCCTCAGG - Intergenic
1078758703 11:14234631-14234653 CACCCACCGGAGGCAGCCCTTGG + Intronic
1080388802 11:31825935-31825957 CCCCGCCAGATGACAGCCTTGGG - Intronic
1083570754 11:63761299-63761321 CCCCCTGCCGAGGCAGCCTTGGG + Exonic
1084486206 11:69449768-69449790 CCCGGCCCGGTGGCTGGCTTGGG - Intergenic
1084805714 11:71577313-71577335 CCCCGTCCCCAGACAGCCTTGGG + Intergenic
1086349839 11:85934692-85934714 GCCCGCCCAGTGGCGGCCTTCGG - Intergenic
1089700627 11:120241827-120241849 CCCAGCAGGGAGGCAGCCTGGGG + Intronic
1092039002 12:5367010-5367032 TCCGGCCCTGACGCAGCCTTGGG - Intergenic
1098029041 12:66235384-66235406 CCCCGGGCCGAGGCAGCTTTGGG + Intronic
1100866620 12:98864593-98864615 CTCTGCCAGCAGGCAGCCTTTGG + Intronic
1101970730 12:109310104-109310126 CCCCGCCTGGAGCCAGCCGCGGG + Intergenic
1103613341 12:122137400-122137422 CGCCACCAGGAGGCAGCCTGGGG - Intronic
1103914923 12:124371234-124371256 CCCCTCCCTGAGCCACCCTTTGG + Intronic
1103935571 12:124474804-124474826 CCCCGCCCTGTGCCATCCTTGGG + Intronic
1104038081 12:125112315-125112337 CAGAGCCCGGAGGCAGCCTTGGG + Intronic
1104704590 12:130933774-130933796 CCCGACACGGAGGCAGGCTTGGG + Intergenic
1105756174 13:23466442-23466464 CCGCGCCCGGAGGAAGCCCACGG - Intergenic
1105805259 13:23948582-23948604 CCCCTCCCGCAGCCTGCCTTCGG + Intergenic
1106517214 13:30465580-30465602 CCCGGCCCTCAGGCAGCCTGAGG - Intronic
1107132514 13:36911603-36911625 CCCCCCCCCCAGGCAGCCTTTGG - Intronic
1107604001 13:42040729-42040751 CCCCGCCCGGGGCCAGCCACCGG - Intronic
1111298232 13:86311568-86311590 CCCCACAGAGAGGCAGCCTTTGG + Intergenic
1111742732 13:92224961-92224983 CCAAGCCTGGAGGCAGTCTTGGG + Intronic
1112600283 13:100848493-100848515 CGCCTCCCGGAGGCAGCTCTTGG + Intergenic
1113651058 13:112034545-112034567 CTCCGCCTGGAAGCAGCCTCTGG + Intergenic
1115641196 14:35336740-35336762 GCCCCCCCGGGTGCAGCCTTAGG + Intergenic
1119219147 14:72892750-72892772 CCCCGCCCGGACGAAGCCGCAGG - Intronic
1119906825 14:78312702-78312724 CCCGTCCGTGAGGCAGCCTTGGG + Intronic
1121455907 14:94038744-94038766 CCCTGCCCCCAGGCAGCCTACGG - Intronic
1121731792 14:96192568-96192590 CCCCTCCCGGGGGCAGCTCTGGG + Intergenic
1122080428 14:99263236-99263258 CCCTCCAGGGAGGCAGCCTTTGG - Intronic
1122541417 14:102499700-102499722 CCCCTCCCGGAGGCAGCTTCAGG + Exonic
1122813835 14:104302469-104302491 CCCAGCCCAGCGTCAGCCTTGGG + Intergenic
1122917637 14:104866139-104866161 CCCAGCCCCGAGGCAGCCGAAGG + Intronic
1124211548 15:27768941-27768963 CCCAGCCGGGAGGCAGCCAGAGG + Intronic
1125484991 15:40105574-40105596 CCCCTCCTGGAGGGATCCTTGGG - Intronic
1128111366 15:65078135-65078157 GAGCGCCAGGAGGCAGCCTTAGG - Exonic
1128133967 15:65249305-65249327 CCCCGCCCAGGGGCTGCCTGGGG - Intronic
1131933043 15:97467187-97467209 CCCCTCCCAGAGGGAGACTTTGG - Intergenic
1132572662 16:650837-650859 CCCATCCCAGAGGCAGCCCTGGG + Intronic
1132572672 16:650867-650889 CCCATCCCAGAGGCAGCCCTGGG + Intronic
1133802228 16:9092625-9092647 CCCCGCCCCGAGGCCGGCTCAGG - Intronic
1136114747 16:28087541-28087563 CCCAGCCCCCAGGCAGCCTTGGG + Intergenic
1136547985 16:30966039-30966061 CCCCCGCAGGAGGCAGCCTACGG + Exonic
1137984181 16:53093990-53094012 CTCTGCCCGGTGTCAGCCTTGGG + Intronic
1137988514 16:53130616-53130638 CCCCGCCCCGAGGCCGCCCAGGG + Intronic
1142000535 16:87661732-87661754 CCCCGCCCCGTGGCGGCCTGCGG - Intronic
1142238646 16:88935173-88935195 CCCTGACCGGGGGCAGCGTTGGG - Intronic
1142418777 16:89957676-89957698 CCCCGCCGTGGGGCAGCCTGGGG + Intronic
1144739924 17:17576136-17576158 CACCCCCCAGAGACAGCCTTGGG + Intronic
1148804823 17:50258855-50258877 CCCCACAGGGAGACAGCCTTGGG + Intergenic
1150295975 17:64007763-64007785 TCCCTCCAGGAGGGAGCCTTGGG + Exonic
1151355029 17:73553259-73553281 TCCCTACTGGAGGCAGCCTTGGG - Intronic
1152195509 17:78916056-78916078 CCCCGCCCTGAGGGAGGCCTGGG - Intronic
1152198174 17:78929735-78929757 CCCAGCCCAGATGCAGCCTGGGG + Intergenic
1152361455 17:79835009-79835031 CACCGCCCCCAGGTAGCCTTTGG + Exonic
1152537934 17:80961167-80961189 CCCAGCCCTGAGCCAGCCTGGGG + Intronic
1152689417 17:81711316-81711338 CCCAGCCCTAAAGCAGCCTTGGG + Intergenic
1152785166 17:82244003-82244025 CCCTGCCCCGCGGCAGCCTGCGG + Exonic
1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG + Intronic
1160586174 18:79914808-79914830 CCCTGCCCAGAGGGAGCCTCAGG + Intronic
1160846433 19:1168184-1168206 CCCCACCCCGGGGCAGCGTTGGG + Intronic
1162051063 19:8033385-8033407 CCCCACCGGGAGTCTGCCTTTGG + Intronic
1162966344 19:14157957-14157979 CTCCACCAGGCGGCAGCCTTGGG + Exonic
1163112430 19:15169857-15169879 ACCTGCCCGGAGGGACCCTTGGG + Intronic
1163763730 19:19150913-19150935 CCCCGCCCCCGGCCAGCCTTAGG + Intronic
1163795298 19:19334492-19334514 CCACGGCTGGGGGCAGCCTTGGG - Intronic
1165273719 19:34731767-34731789 CCCAGCCCCGAGCCAGCCTCAGG + Intergenic
1166107352 19:40603930-40603952 CCCCGCCCAGAGGTGGCCTGGGG + Intronic
1166107741 19:40605679-40605701 CCCCGCGCGGAGGCAAGCTCCGG - Intronic
1166882955 19:45940235-45940257 CCCGGCCCCGAGGTAGCCGTTGG + Exonic
1168294672 19:55372930-55372952 CCCCTCACTGACGCAGCCTTGGG - Intergenic
925688561 2:6496529-6496551 CCCAGTGGGGAGGCAGCCTTAGG + Intergenic
926166849 2:10526430-10526452 ACCCGGCCGGAGCCAGGCTTCGG + Intergenic
933655206 2:84881121-84881143 CCCCGCCCGGAGGCGCCCCGCGG - Exonic
935396955 2:102619510-102619532 CCCCGCCCGCGGGCCGCCCTGGG + Intergenic
938073943 2:128322260-128322282 CCCGACCCGGCGGCAGGCTTGGG + Intergenic
939063785 2:137457390-137457412 CCCTGCCCAAGGGCAGCCTTAGG - Intronic
939131860 2:138244544-138244566 CCCCACCCAGAGGCTGACTTGGG - Intergenic
941812642 2:169768931-169768953 CCCGACCCGGAGGCGGCGTTGGG + Intronic
948708021 2:239807201-239807223 CCCAGCCTGGAGGCAGCGTGAGG - Intergenic
1172222412 20:33283064-33283086 CCCCGCCCGGAGGCAGCCTTGGG - Intronic
1173809770 20:45948736-45948758 CCCAGCCTGCAGGCAGGCTTTGG - Exonic
1175332248 20:58173304-58173326 CCCCGCCCCACGGCAGCCATTGG - Intergenic
1175993077 20:62799097-62799119 CCCTGCCTGAAGGCAGTCTTGGG - Intronic
1176366791 21:6038053-6038075 GCCAGCGCGCAGGCAGCCTTCGG - Intergenic
1179756727 21:43500491-43500513 GCCAGCGCGCAGGCAGCCTTCGG + Intergenic
1180155285 21:45974530-45974552 CGCTGGCCGGAGGCAGCCTGCGG - Intergenic
1180255143 21:46621756-46621778 CCCAGCCAGCAGGCAGCCATGGG + Intergenic
1180649987 22:17369605-17369627 CCCCGCCCGGCGCCCGCCCTCGG + Exonic
1180843882 22:18971184-18971206 CCCGCCCTGGAGGCAGCGTTGGG - Intergenic
1180871612 22:19150024-19150046 CCCAGCCCGGCGGCCGCCTCTGG + Exonic
1183482310 22:38071838-38071860 CCCAGCCCAGAGGGAGCCTGAGG - Intronic
1183537722 22:38412952-38412974 CGCCGCCCGGTGGCCGCCTCCGG - Intergenic
1184265490 22:43343691-43343713 CCCGGCCCAGAGGCAGCCTCGGG + Intergenic
950509777 3:13419468-13419490 ACCCGCGCCGAGGCAGCCTGAGG + Intronic
950670822 3:14524379-14524401 CCCCGCCCGGTGGGTGCCCTTGG - Exonic
954445962 3:50547045-50547067 CCTGGCCCTGAAGCAGCCTTGGG - Intergenic
954778858 3:53045315-53045337 CCCCGCCCGGAGCGAGCCCGGGG + Intronic
960971416 3:123142694-123142716 CCCAGCCCAGGGGCAGCCTCTGG + Intronic
963253368 3:143121131-143121153 GCCCGGCCGGAGGCGGCCCTGGG - Exonic
965530334 3:169764797-169764819 CCCCGCCTGGAGGCCGCGGTCGG - Intergenic
968500123 4:946002-946024 CCCTGCCCTGAGACAGCCTCCGG + Intronic
969043571 4:4320261-4320283 CCCCTCCAGCAGACAGCCTTTGG - Intronic
969503645 4:7570388-7570410 GCCCACCCGGAAGCAGCCTCTGG - Intronic
970004344 4:11396410-11396432 CCCGGCCCGGGAGCAGCCTGGGG - Exonic
978741775 4:112145491-112145513 CGCCGCCCGAAGGCTGCCCTGGG - Exonic
985710259 5:1423941-1423963 GCCCGGCCGAATGCAGCCTTGGG + Intronic
990977951 5:61575417-61575439 CCCTGCCCTGGAGCAGCCTTGGG + Intergenic
996765508 5:127030998-127031020 CCCCGCCCGGAGGAAGCTGAGGG + Intergenic
997464792 5:134079973-134079995 CCCCCACCGCAGGCCGCCTTTGG - Intergenic
1002305448 5:178280159-178280181 CCAGGGCTGGAGGCAGCCTTCGG - Intronic
1004891776 6:20107908-20107930 ACATGCCCGGAAGCAGCCTTTGG - Intronic
1006802195 6:36766286-36766308 GCCTGCCAGGAGTCAGCCTTGGG + Intronic
1011022822 6:82833272-82833294 CCCCACCCAGAGGCAGACTCAGG - Intergenic
1015039819 6:128703543-128703565 CCCTGCCCCCCGGCAGCCTTGGG + Intergenic
1017042909 6:150322270-150322292 CCCCGAACGGAGGGAACCTTGGG - Intergenic
1017777204 6:157689525-157689547 CCACGCCCAGAGGCGCCCTTGGG + Intergenic
1017793501 6:157822627-157822649 CCCCGGCCTGAGGGAGCCTCCGG + Intronic
1019299452 7:296087-296109 CCCAGGCCGCAGGCAGCCTCCGG - Intergenic
1019428882 7:989418-989440 CCCCGCCCCAAGGAAGCCTCTGG - Exonic
1022105345 7:27192714-27192736 CCCGGGCGGGAGGCAGCCTCGGG - Intergenic
1023221250 7:37921398-37921420 CCCCGCCAGCAGGCCGCCCTCGG - Intronic
1024219140 7:47274038-47274060 CCCCGACCAGAGCCAGCCCTGGG - Intergenic
1027242146 7:76337919-76337941 CCAAGCCTGGAGGCAGTCTTGGG + Intronic
1029639898 7:101814369-101814391 CCCCACACGGAGGCAGCCCTTGG + Intergenic
1030108832 7:106009328-106009350 ACCCGCCCTTATGCAGCCTTGGG - Intronic
1031073643 7:117190841-117190863 CCCCGCCGAGATGCAGCCTCAGG - Exonic
1035642470 8:1194433-1194455 CCCCACCTGGAGGCCGCCCTGGG - Intergenic
1049797129 8:144501944-144501966 CACCGTGGGGAGGCAGCCTTGGG - Exonic
1056143425 9:83707147-83707169 CCCCGCCCGGAGGCTGGCGGTGG + Intronic
1057040792 9:91846064-91846086 CCCAGCCGGGAGGCATCCTGGGG - Intronic
1057265393 9:93614064-93614086 CCTCTCCCGTTGGCAGCCTTGGG - Intronic
1062624544 9:137436843-137436865 CCCCGCCCTCAGGCAGCCTGTGG + Intronic
1062666050 9:137673020-137673042 TCCAGCCCGGTGTCAGCCTTCGG - Intronic
1187443107 X:19337678-19337700 CCCCAAACGGAAGCAGCCTTTGG - Intergenic
1195269414 X:103215397-103215419 CCCGGCCCGGAGGGAGCCGGCGG + Intronic
1201885788 Y:18880351-18880373 CCCTGCCGGGAGGCAGCTTAAGG - Intergenic