ID: 1172222412

View in Genome Browser
Species Human (GRCh38)
Location 20:33283064-33283086
Sequence CCCCGCCCGGAGGCAGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172222412_1172222418 13 Left 1172222412 20:33283064-33283086 CCCAAGGCTGCCTCCGGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1172222418 20:33283100-33283122 GAAGCCACAAATATTTACCTTGG 0: 1
1: 0
2: 0
3: 10
4: 203
1172222412_1172222421 27 Left 1172222412 20:33283064-33283086 CCCAAGGCTGCCTCCGGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1172222421 20:33283114-33283136 TTACCTTGGAGACCTCGGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 98
1172222412_1172222420 22 Left 1172222412 20:33283064-33283086 CCCAAGGCTGCCTCCGGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1172222420 20:33283109-33283131 AATATTTACCTTGGAGACCTCGG 0: 1
1: 0
2: 1
3: 19
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172222412 Original CRISPR CCCCGCCCGGAGGCAGCCTT GGG (reversed) Intronic