ID: 1172222416

View in Genome Browser
Species Human (GRCh38)
Location 20:33283074-33283096
Sequence TGAACCACAGCCCCGCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172222416_1172222418 3 Left 1172222416 20:33283074-33283096 CCTCCGGGCGGGGCTGTGGTTCA 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1172222418 20:33283100-33283122 GAAGCCACAAATATTTACCTTGG 0: 1
1: 0
2: 0
3: 10
4: 203
1172222416_1172222420 12 Left 1172222416 20:33283074-33283096 CCTCCGGGCGGGGCTGTGGTTCA 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1172222420 20:33283109-33283131 AATATTTACCTTGGAGACCTCGG 0: 1
1: 0
2: 1
3: 19
4: 186
1172222416_1172222423 24 Left 1172222416 20:33283074-33283096 CCTCCGGGCGGGGCTGTGGTTCA 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1172222423 20:33283121-33283143 GGAGACCTCGGCCTGGTCTGAGG 0: 1
1: 0
2: 0
3: 13
4: 175
1172222416_1172222421 17 Left 1172222416 20:33283074-33283096 CCTCCGGGCGGGGCTGTGGTTCA 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1172222421 20:33283114-33283136 TTACCTTGGAGACCTCGGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172222416 Original CRISPR TGAACCACAGCCCCGCCCGG AGG (reversed) Intronic