ID: 1172222417

View in Genome Browser
Species Human (GRCh38)
Location 20:33283077-33283099
Sequence TGCTGAACCACAGCCCCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172222417_1172222423 21 Left 1172222417 20:33283077-33283099 CCGGGCGGGGCTGTGGTTCAGCA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1172222423 20:33283121-33283143 GGAGACCTCGGCCTGGTCTGAGG 0: 1
1: 0
2: 0
3: 13
4: 175
1172222417_1172222418 0 Left 1172222417 20:33283077-33283099 CCGGGCGGGGCTGTGGTTCAGCA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1172222418 20:33283100-33283122 GAAGCCACAAATATTTACCTTGG 0: 1
1: 0
2: 0
3: 10
4: 203
1172222417_1172222421 14 Left 1172222417 20:33283077-33283099 CCGGGCGGGGCTGTGGTTCAGCA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1172222421 20:33283114-33283136 TTACCTTGGAGACCTCGGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 98
1172222417_1172222420 9 Left 1172222417 20:33283077-33283099 CCGGGCGGGGCTGTGGTTCAGCA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1172222420 20:33283109-33283131 AATATTTACCTTGGAGACCTCGG 0: 1
1: 0
2: 1
3: 19
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172222417 Original CRISPR TGCTGAACCACAGCCCCGCC CGG (reversed) Intronic