ID: 1172222418

View in Genome Browser
Species Human (GRCh38)
Location 20:33283100-33283122
Sequence GAAGCCACAAATATTTACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172222417_1172222418 0 Left 1172222417 20:33283077-33283099 CCGGGCGGGGCTGTGGTTCAGCA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1172222418 20:33283100-33283122 GAAGCCACAAATATTTACCTTGG 0: 1
1: 0
2: 0
3: 10
4: 203
1172222406_1172222418 30 Left 1172222406 20:33283047-33283069 CCTCAGGAAGCTGGAGTCCCAAG 0: 1
1: 0
2: 1
3: 25
4: 282
Right 1172222418 20:33283100-33283122 GAAGCCACAAATATTTACCTTGG 0: 1
1: 0
2: 0
3: 10
4: 203
1172222416_1172222418 3 Left 1172222416 20:33283074-33283096 CCTCCGGGCGGGGCTGTGGTTCA 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1172222418 20:33283100-33283122 GAAGCCACAAATATTTACCTTGG 0: 1
1: 0
2: 0
3: 10
4: 203
1172222412_1172222418 13 Left 1172222412 20:33283064-33283086 CCCAAGGCTGCCTCCGGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1172222418 20:33283100-33283122 GAAGCCACAAATATTTACCTTGG 0: 1
1: 0
2: 0
3: 10
4: 203
1172222414_1172222418 12 Left 1172222414 20:33283065-33283087 CCAAGGCTGCCTCCGGGCGGGGC 0: 1
1: 0
2: 3
3: 42
4: 451
Right 1172222418 20:33283100-33283122 GAAGCCACAAATATTTACCTTGG 0: 1
1: 0
2: 0
3: 10
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172222418 Original CRISPR GAAGCCACAAATATTTACCT TGG Intronic