ID: 1172222420

View in Genome Browser
Species Human (GRCh38)
Location 20:33283109-33283131
Sequence AATATTTACCTTGGAGACCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172222417_1172222420 9 Left 1172222417 20:33283077-33283099 CCGGGCGGGGCTGTGGTTCAGCA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1172222420 20:33283109-33283131 AATATTTACCTTGGAGACCTCGG 0: 1
1: 0
2: 1
3: 19
4: 186
1172222414_1172222420 21 Left 1172222414 20:33283065-33283087 CCAAGGCTGCCTCCGGGCGGGGC 0: 1
1: 0
2: 3
3: 42
4: 451
Right 1172222420 20:33283109-33283131 AATATTTACCTTGGAGACCTCGG 0: 1
1: 0
2: 1
3: 19
4: 186
1172222416_1172222420 12 Left 1172222416 20:33283074-33283096 CCTCCGGGCGGGGCTGTGGTTCA 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1172222420 20:33283109-33283131 AATATTTACCTTGGAGACCTCGG 0: 1
1: 0
2: 1
3: 19
4: 186
1172222412_1172222420 22 Left 1172222412 20:33283064-33283086 CCCAAGGCTGCCTCCGGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1172222420 20:33283109-33283131 AATATTTACCTTGGAGACCTCGG 0: 1
1: 0
2: 1
3: 19
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172222420 Original CRISPR AATATTTACCTTGGAGACCT CGG Intronic