ID: 1172222423

View in Genome Browser
Species Human (GRCh38)
Location 20:33283121-33283143
Sequence GGAGACCTCGGCCTGGTCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172222416_1172222423 24 Left 1172222416 20:33283074-33283096 CCTCCGGGCGGGGCTGTGGTTCA 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1172222423 20:33283121-33283143 GGAGACCTCGGCCTGGTCTGAGG 0: 1
1: 0
2: 0
3: 13
4: 175
1172222417_1172222423 21 Left 1172222417 20:33283077-33283099 CCGGGCGGGGCTGTGGTTCAGCA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1172222423 20:33283121-33283143 GGAGACCTCGGCCTGGTCTGAGG 0: 1
1: 0
2: 0
3: 13
4: 175
1172222419_1172222423 -6 Left 1172222419 20:33283104-33283126 CCACAAATATTTACCTTGGAGAC 0: 1
1: 0
2: 2
3: 8
4: 170
Right 1172222423 20:33283121-33283143 GGAGACCTCGGCCTGGTCTGAGG 0: 1
1: 0
2: 0
3: 13
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172222423 Original CRISPR GGAGACCTCGGCCTGGTCTG AGG Exonic