ID: 1172225569

View in Genome Browser
Species Human (GRCh38)
Location 20:33303046-33303068
Sequence CAGGGTGAACAAAGGGCGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172225569_1172225579 20 Left 1172225569 20:33303046-33303068 CCCTCCGCCCTTTGTTCACCCTG 0: 1
1: 0
2: 2
3: 9
4: 189
Right 1172225579 20:33303089-33303111 CTGCGATATTGGCAGCAACCAGG 0: 1
1: 0
2: 0
3: 3
4: 52
1172225569_1172225578 9 Left 1172225569 20:33303046-33303068 CCCTCCGCCCTTTGTTCACCCTG 0: 1
1: 0
2: 2
3: 9
4: 189
Right 1172225578 20:33303078-33303100 AGTTCAGTTGTCTGCGATATTGG 0: 1
1: 0
2: 0
3: 5
4: 90
1172225569_1172225581 22 Left 1172225569 20:33303046-33303068 CCCTCCGCCCTTTGTTCACCCTG 0: 1
1: 0
2: 2
3: 9
4: 189
Right 1172225581 20:33303091-33303113 GCGATATTGGCAGCAACCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 59
1172225569_1172225582 23 Left 1172225569 20:33303046-33303068 CCCTCCGCCCTTTGTTCACCCTG 0: 1
1: 0
2: 2
3: 9
4: 189
Right 1172225582 20:33303092-33303114 CGATATTGGCAGCAACCAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1172225569_1172225580 21 Left 1172225569 20:33303046-33303068 CCCTCCGCCCTTTGTTCACCCTG 0: 1
1: 0
2: 2
3: 9
4: 189
Right 1172225580 20:33303090-33303112 TGCGATATTGGCAGCAACCAGGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172225569 Original CRISPR CAGGGTGAACAAAGGGCGGA GGG (reversed) Exonic
900587781 1:3441530-3441552 CAGGCTGAACAAAGATGGGAAGG - Intergenic
902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG + Exonic
903768253 1:25748483-25748505 CAGGGTGAACACAGGACACAGGG - Intronic
903838743 1:26223255-26223277 CATAGAGAATAAAGGGCGGACGG - Intergenic
904837705 1:33349763-33349785 CGGCGTCAACAAAGGGCGGCCGG + Intronic
914720194 1:150282910-150282932 CCTGGCGAACAACGGGCGGAGGG + Exonic
920198804 1:204246646-204246668 CTGGGTGAAGAAAAGGCAGAGGG + Intronic
921016707 1:211198411-211198433 TAGGGTCCAAAAAGGGCGGAAGG - Intergenic
1062895700 10:1101582-1101604 CTGTGTGAACAAACTGCGGAGGG - Intronic
1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG + Intergenic
1069705064 10:70453851-70453873 GAGGGATAACAAAGGGCAGAAGG + Intergenic
1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG + Exonic
1072802118 10:98399534-98399556 CAGGATGAACACATGTCGGATGG - Intronic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1075940277 10:126385727-126385749 TAGGGTGAGCAAAGGGAGAATGG + Intronic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1080042069 11:27769470-27769492 CAGGGTGCAGAAAGGGTGGGAGG + Intergenic
1080925945 11:36755926-36755948 CAGGGTGAATAAGGTGAGGATGG + Intergenic
1083623719 11:64061304-64061326 CAGCGTGAAGGAAGGGCAGACGG - Intronic
1084068984 11:66721559-66721581 CGGGGTGAAGAAAGGGGTGATGG + Intronic
1084972709 11:72780533-72780555 CAGGGTGCAGAAAGCGGGGAAGG + Intronic
1087735329 11:101826437-101826459 CTGGCTGAACAAAGGATGGAAGG + Intronic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1091803867 12:3342410-3342432 CAGCCTGAACAAAGGGCCAAAGG - Intergenic
1093491203 12:19706733-19706755 GAGGGTGAAAAATGGGAGGAGGG + Intronic
1093802247 12:23388510-23388532 GAGGGTGGAGAAAGGGAGGAGGG + Intergenic
1093955638 12:25214863-25214885 CAGGGGGAAAAGAGGGCGGTAGG + Intronic
1095349246 12:41189100-41189122 CAGGGTAAGCAAAGGGGGGTGGG + Exonic
1096148214 12:49293581-49293603 CAGGACGCACAAAGGGGGGAGGG + Intronic
1096678823 12:53241633-53241655 CAGTGTGAACAAAGGACTGGAGG + Intergenic
1098540900 12:71656106-71656128 CCAGGTGAACTAAGGGCTGAGGG + Intronic
1099245255 12:80186436-80186458 CAGGGAGACCAAAGAGCAGAGGG - Intergenic
1101396818 12:104355963-104355985 GAGGGTGAGGAAAGGGTGGAAGG + Intergenic
1103612646 12:122133535-122133557 CATGGTGAAGACAGGGAGGAAGG - Exonic
1103793146 12:123485719-123485741 CAGGGTGAACCGGGGGCGGTTGG + Exonic
1104556903 12:129808743-129808765 CAGAATGAACAAAGGCGGGAAGG + Intronic
1104969411 12:132524419-132524441 CAGGGTGCACACAAGGCAGACGG - Intronic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1109527948 13:63600924-63600946 GAGAGTGAAGAAAGGGAGGAGGG - Intergenic
1112175430 13:97018771-97018793 CAGGGTGAGCACAGGGCCCAGGG - Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1116918473 14:50548278-50548300 TAGGGTGTACAATGGGCTGAGGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118426196 14:65665930-65665952 GAGGGTGGACAATGGGAGGAGGG + Intronic
1118442912 14:65828157-65828179 CAAGGTGGTCAAGGGGCGGATGG + Intergenic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1120939658 14:89935143-89935165 CATGATGAACAAAGGGCCGTCGG - Intronic
1121017757 14:90558708-90558730 CAGTGTGAACAGAGGCCGGCAGG - Intronic
1121247306 14:92471277-92471299 CAAGGAGGACAAAGGGCAGAAGG + Intronic
1122687719 14:103518013-103518035 CGAGGTGAACACAGGGCTGAGGG - Intergenic
1122706975 14:103628102-103628124 CAGGGTTCACAAAGGGCTGCTGG + Intronic
1124631630 15:31340978-31341000 CAGGATGAACACAGGGCACAGGG - Intronic
1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG + Intergenic
1126181583 15:45790760-45790782 CAGACTGAACAAGGGGCAGATGG - Intergenic
1129181802 15:73882413-73882435 AAGGGTGAACCAAGGACAGAGGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131857722 15:96616578-96616600 CAGGGAGACCAAAGGCCGGGAGG - Intergenic
1132211543 15:100027073-100027095 CAGGGTGAACAACAGTCGGGAGG + Intronic
1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG + Intronic
1132534529 16:471510-471532 CACGGTGCACACAGGGCGGGAGG - Intronic
1133740380 16:8646830-8646852 CAGAGAGACCAAGGGGCGGAGGG - Exonic
1135405197 16:22192562-22192584 CAGGGAGAAGAAAGAGAGGAAGG - Intergenic
1137826959 16:51506397-51506419 CAGTGTGAAGAAAGGATGGAAGG - Intergenic
1138439481 16:57025588-57025610 CAGGGTTAACAAGGGCCCGAGGG + Exonic
1139072553 16:63401037-63401059 CAGGGTTAACTAAGAGTGGAAGG + Intergenic
1139332661 16:66205557-66205579 GAGGGGGAACAAAGGGAGGGAGG + Intergenic
1142280963 16:89147315-89147337 CAGAGTGAGCAAGGGGGGGAGGG + Intronic
1143865357 17:9919148-9919170 AAGGGTGAACAACAGGCGGCAGG - Intronic
1146004981 17:29155419-29155441 CAGGGTCCACACAGGGCGGCAGG - Intronic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147376770 17:40027205-40027227 CAATGTGAACATAGGGCTGAAGG + Intronic
1147684211 17:42276982-42277004 CAGGGTGAACCTACGGGGGACGG + Intergenic
1149013292 17:51880204-51880226 CAGGAGGAATAAAGGGAGGAGGG - Intronic
1152395723 17:80031633-80031655 AAGGGTGCACAAATGGCAGATGG - Intronic
1154194442 18:12255025-12255047 CAGGGGGGACAAGGGGCGGGTGG + Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1157546323 18:48549146-48549168 CAGGGTGCACATAGGGGTGATGG + Intronic
1158900407 18:61957151-61957173 CAGGGTGGACAACTGGCAGAAGG - Intergenic
1159325969 18:66918312-66918334 GAAGGTGAAGAAAGGGAGGAAGG - Intergenic
1159931399 18:74316021-74316043 CAGGGGGAGGAAAGGGCGGGTGG - Exonic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1163541915 19:17916593-17916615 CAAGGTGAACAAAGGCTGCAGGG + Intergenic
1165655846 19:37531555-37531577 CAGTGGGAACAAAGGCCGGGGGG - Intronic
1166318373 19:42001635-42001657 AAGGCTCAACAAAGGGTGGAGGG - Intronic
1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG + Intronic
927012144 2:18914948-18914970 GAGGGTGAAAGAAGTGCGGAAGG + Intergenic
927279154 2:21288478-21288500 CAGAGTGAACAAAGGGCTGTAGG + Intergenic
927374294 2:22395559-22395581 CAGGGTGAACAAAAGATAGAAGG + Intergenic
930698057 2:54431396-54431418 CAGGATGAAGAATGGGTGGACGG + Intergenic
935580347 2:104750739-104750761 CAGGGTGAAGACAGGGAGGTGGG - Intergenic
936474011 2:112824051-112824073 CAGCATGAACAATGGGTGGAGGG - Intergenic
937097492 2:119245246-119245268 CAGGAGGGACAAAGGGTGGAGGG + Intronic
937954815 2:127416238-127416260 CAGGCTGCCCAGAGGGCGGAAGG - Intergenic
938201428 2:129376026-129376048 AAGGCTGAACACAGGGCTGAGGG - Intergenic
938743933 2:134259494-134259516 CAGGGTTAACAACGTGTGGATGG - Intronic
938938701 2:136149700-136149722 CAGTGTGAACAACTGGCTGAGGG + Intergenic
939754247 2:146090056-146090078 CAGGGTGAAGGAAGGGAGAAGGG - Intergenic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
944473413 2:200079819-200079841 CAAGGTGGACAAAAGGCAGAAGG + Intergenic
946394471 2:219436195-219436217 CAGTGTGAAGAAAAGGCTGAGGG + Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947821319 2:233073070-233073092 CAGGGTGAGTGAAGGGGGGATGG - Intronic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1170640769 20:18150689-18150711 CAGAGCGAACAAAGGACGGACGG - Intronic
1170679221 20:18510054-18510076 CAAAGTTAACAAAGTGCGGAAGG + Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173705158 20:45104799-45104821 CAGGGTAAAGAAAGGGCAGGAGG - Intergenic
1175206894 20:57317971-57317993 CAGGGGGCACAAGGGGCAGAAGG - Intergenic
1176357860 21:5967278-5967300 CTGCGTGGACAGAGGGCGGAGGG + Intergenic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1179714907 21:43281619-43281641 CAGGATGAACATCGGGAGGAGGG - Intergenic
1179765658 21:43571273-43571295 CTGCGTGGACAGAGGGCGGAGGG - Intronic
1179874838 21:44262358-44262380 AAGGGTGAAGAAAGGGATGAGGG + Intergenic
1180783506 22:18534702-18534724 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181058598 22:20271339-20271361 CGAGGTGAACAAAGGAGGGATGG - Intronic
1181127073 22:20708753-20708775 CGGCCTGAACAAAGGGAGGATGG - Intronic
1181240408 22:21474054-21474076 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181490667 22:23258993-23259015 CAGGCGGAACAAAGGGAGCACGG + Intronic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1182573767 22:31259080-31259102 AAGGGTGTACAAAGGGAGGAAGG - Intronic
1183043151 22:35198381-35198403 CAGGGTGAAGAAGGGGGAGAGGG - Intergenic
1184253762 22:43275768-43275790 CAGGGAGAACAACAGGCAGATGG + Intronic
1184849513 22:47112286-47112308 CTGGGTGAACACTGGGCAGAAGG - Intronic
1184927252 22:47651496-47651518 CAGGGTGGTCAAAGGGCACAGGG + Intergenic
949643245 3:6063916-6063938 CAGGAAGAACAAAGGTGGGATGG + Intergenic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950548218 3:13651656-13651678 CAGGCTGAACACAGGGCTGTAGG - Intergenic
952575356 3:34767929-34767951 CAGGTTTATCAAAGGGCAGATGG - Intergenic
952687513 3:36167290-36167312 GAGGGTGAAGAATGGGAGGAGGG - Intergenic
953695923 3:45159133-45159155 GAGGGTGAAGAATGGGAGGAGGG - Intergenic
956212364 3:66814940-66814962 CAGGGAGAGAAAAGGGCTGAAGG - Intergenic
957785323 3:84875039-84875061 CAGCGTGAACAGAGGGCCTATGG - Intergenic
959438918 3:106352457-106352479 GAGGGTGAAGAATGGGAGGAAGG - Intergenic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961910261 3:130307603-130307625 CAGGGAGAAGAATGGGAGGAGGG + Intergenic
962437871 3:135383149-135383171 CAGGGAGAATGCAGGGCGGAAGG + Intergenic
962996967 3:140639339-140639361 CAAGGTAAACAAAGAGCAGAAGG - Intergenic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
968488025 4:873590-873612 CAGGCAGCACAAAGGGCAGAAGG - Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
971748987 4:30622052-30622074 CAGCATGAACAAAGGGCTGTGGG - Intergenic
973709081 4:53608958-53608980 GAGGGTGGAGAAAGGGAGGAGGG + Intronic
975240012 4:72046407-72046429 CAGAGAGAACAAAAGGCGGCTGG - Intronic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985589925 5:759257-759279 CAGTGTTAACAAAGGGCGCAGGG - Intronic
985966017 5:3339217-3339239 CACGGTGCACAAAGAGCAGAGGG + Intergenic
986703913 5:10439826-10439848 CAGGGTGAACACAGAGGTGATGG - Exonic
995229250 5:109740054-109740076 CAGGCTTAACAAAGGGCTGGAGG - Intronic
995308729 5:110687101-110687123 CAGGGGGAAGAAAGGTCAGAAGG - Intronic
996305389 5:122040497-122040519 GAGGGTCAATAAAGGGAGGAGGG + Intronic
997127500 5:131242902-131242924 CATTGTGAACAAAGGGCACAGGG + Intergenic
1000129034 5:158276943-158276965 CAGTGTGAACCAAGGCCTGAAGG + Intergenic
1001777283 5:174338059-174338081 GAGGCTGATCAAAGGGCTGAAGG + Intergenic
1002440624 5:179262563-179262585 CAGCGTGACCAAGGGGCAGAAGG - Intronic
1003337441 6:5187228-5187250 CAGGGTGAAGACAGGGTGGCTGG + Intronic
1007220584 6:40275769-40275791 CAGGGTAAAGAAAGGGAGTAGGG - Intergenic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1017739071 6:157389768-157389790 CAGTGGGTACAAAGGGTGGAAGG - Intronic
1018323768 6:162641703-162641725 TAGAGTTAACAGAGGGCGGATGG - Intronic
1019334897 7:478438-478460 AAGGGAGGACAAAGGGAGGAAGG + Intergenic
1019480499 7:1264582-1264604 CAGGGTGCACACAGGGTGGGTGG - Intergenic
1020391721 7:7665671-7665693 CAGAGGGAACAAAGGAAGGAGGG - Intronic
1021432496 7:20576457-20576479 CAGGTTGAAAAAATGGAGGAAGG - Intergenic
1023452769 7:40305059-40305081 CAGGGTGAAGAAAGGAGGAAAGG - Intronic
1024752456 7:52483501-52483523 CAGGGACAACAAAGGCCGGCAGG + Intergenic
1026149623 7:67776921-67776943 CAGGATGTGCAAAGGGCTGAAGG - Intergenic
1026988505 7:74569769-74569791 CAGGGTGTGAAGAGGGCGGAAGG + Intronic
1031068392 7:117134020-117134042 CAGGGTAATCAAAGAGGGGAAGG - Intronic
1031350713 7:120727749-120727771 CAGGGTGAAAAAGGAGCAGAAGG + Intronic
1031483936 7:122306681-122306703 CAGGCTGAAGAAATGGGGGAGGG + Intronic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1034899258 7:154897416-154897438 CAGCAGGAAAAAAGGGCGGAAGG - Intergenic
1036236504 8:7043570-7043592 GCGGGTGGACAAAGGGCTGAGGG - Intergenic
1036911318 8:12759558-12759580 CAGGGTGCACAAAGTGCGCAAGG + Intergenic
1038570546 8:28658345-28658367 GAGGGTGAAAACAGGGTGGATGG - Intronic
1040435043 8:47381913-47381935 CTGGTAGAACAAAGGGAGGATGG - Intronic
1040549687 8:48428545-48428567 GAGGGTGAACCAAGGAAGGAGGG + Intergenic
1044416866 8:91948972-91948994 CAGGGTGAAGAAGGGGTTGAGGG - Intergenic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050062721 9:1727291-1727313 CAGGGTGCACAATGGGCTCAAGG + Intergenic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1050701327 9:8342941-8342963 TAGTATGAACAAAGGACGGATGG + Intronic
1052049585 9:23830208-23830230 CAGGGAGAAGAACGGGGGGAGGG - Intergenic
1055783607 9:79847312-79847334 CAGAGAGAACAAAGGGCAAAGGG - Intergenic
1058387881 9:104460189-104460211 CTGAGTGAACAAGGGGAGGATGG + Intergenic
1058935821 9:109768198-109768220 CAGGGAGAAAAAAGGAAGGAAGG + Intronic
1060106979 9:120878659-120878681 CAGGGGGATCAAGGGGCAGAAGG - Intronic
1060688580 9:125635439-125635461 CAGCCTGAACATAGGGTGGAAGG - Intronic
1061246940 9:129405401-129405423 CGGGGGGAACAAAAGGGGGACGG + Intergenic
1061359575 9:130132421-130132443 CAGGGTGGACACAGGACGGCAGG - Intronic
1187391935 X:18891750-18891772 CAGGGTGACCCAAGGGGGCAGGG + Intergenic
1187619469 X:21034658-21034680 CAGGGTGAAAAAATGGGGGTGGG - Intergenic
1191873468 X:65770046-65770068 CAGGATGAAGAAAGGGTGAAGGG - Intergenic
1194535622 X:95103204-95103226 CAGGGTGAGCAATGGGGGCATGG + Intergenic
1195282447 X:103349002-103349024 CAGGGTGAAGGAAGAGTGGAGGG - Intergenic
1201586719 Y:15569208-15569230 CAGGCTGAACAAATGGGGGAAGG + Intergenic