ID: 1172225579

View in Genome Browser
Species Human (GRCh38)
Location 20:33303089-33303111
Sequence CTGCGATATTGGCAGCAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172225577_1172225579 1 Left 1172225577 20:33303065-33303087 CCTGGGCATCGTGAGTTCAGTTG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1172225579 20:33303089-33303111 CTGCGATATTGGCAGCAACCAGG 0: 1
1: 0
2: 0
3: 3
4: 52
1172225573_1172225579 16 Left 1172225573 20:33303050-33303072 CCGCCCTTTGTTCACCCTGGGCA 0: 1
1: 0
2: 1
3: 14
4: 187
Right 1172225579 20:33303089-33303111 CTGCGATATTGGCAGCAACCAGG 0: 1
1: 0
2: 0
3: 3
4: 52
1172225569_1172225579 20 Left 1172225569 20:33303046-33303068 CCCTCCGCCCTTTGTTCACCCTG 0: 1
1: 0
2: 2
3: 9
4: 189
Right 1172225579 20:33303089-33303111 CTGCGATATTGGCAGCAACCAGG 0: 1
1: 0
2: 0
3: 3
4: 52
1172225574_1172225579 13 Left 1172225574 20:33303053-33303075 CCCTTTGTTCACCCTGGGCATCG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1172225579 20:33303089-33303111 CTGCGATATTGGCAGCAACCAGG 0: 1
1: 0
2: 0
3: 3
4: 52
1172225568_1172225579 29 Left 1172225568 20:33303037-33303059 CCAGTGAAGCCCTCCGCCCTTTG 0: 1
1: 0
2: 0
3: 25
4: 122
Right 1172225579 20:33303089-33303111 CTGCGATATTGGCAGCAACCAGG 0: 1
1: 0
2: 0
3: 3
4: 52
1172225570_1172225579 19 Left 1172225570 20:33303047-33303069 CCTCCGCCCTTTGTTCACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1172225579 20:33303089-33303111 CTGCGATATTGGCAGCAACCAGG 0: 1
1: 0
2: 0
3: 3
4: 52
1172225575_1172225579 12 Left 1172225575 20:33303054-33303076 CCTTTGTTCACCCTGGGCATCGT 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1172225579 20:33303089-33303111 CTGCGATATTGGCAGCAACCAGG 0: 1
1: 0
2: 0
3: 3
4: 52
1172225576_1172225579 2 Left 1172225576 20:33303064-33303086 CCCTGGGCATCGTGAGTTCAGTT 0: 1
1: 0
2: 2
3: 9
4: 74
Right 1172225579 20:33303089-33303111 CTGCGATATTGGCAGCAACCAGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172225579 Original CRISPR CTGCGATATTGGCAGCAACC AGG Intronic
900971290 1:5993562-5993584 CTGCGGCATTAGCAGCAGCCGGG + Intronic
904192321 1:28755211-28755233 CTGTGATAGTAGCAGCAGCCAGG + Intronic
912849538 1:113110409-113110431 GTTCGTTATTGGCAGCAAGCTGG + Exonic
919958429 1:202441286-202441308 CAGCGGTATTGGCATCACCCGGG + Intronic
920775993 1:208937725-208937747 CTCTGATACTAGCAGCAACCTGG - Intergenic
921654265 1:217715584-217715606 CTGTCATATTGGCATCAACTGGG + Intronic
1064886868 10:20121900-20121922 ATGGGATATTGGCATCAATCGGG + Intronic
1066084045 10:31959760-31959782 CTGTGATAATGGTAGTAACCTGG + Intergenic
1078455350 11:11470620-11470642 CTGAGATATTGGCAGAGACAGGG + Intronic
1091712054 12:2749133-2749155 CTGCCATCTTGCCAGCCACCAGG - Intergenic
1092576987 12:9795843-9795865 AGGTGATATTGGCAGCATCCTGG + Intergenic
1100722509 12:97373842-97373864 ATGTGAGATTAGCAGCAACCGGG + Intergenic
1112011371 13:95296554-95296576 CTGAGATATGGCCAGCAACAGGG + Intronic
1116206491 14:41874095-41874117 CTGCTATATTGGAAGAAACAGGG + Intronic
1129162501 15:73754252-73754274 CTTTGATATTGGGAGGAACCTGG + Intergenic
1130878232 15:88032577-88032599 CTGCCTTATTGGGAGCACCCAGG + Intronic
1131698406 15:94905328-94905350 CTGCTACATTGGCAGTAAACGGG - Intergenic
1133525050 16:6596944-6596966 CTGTGCTAGTGGCAGAAACCAGG - Intronic
1141448451 16:84079764-84079786 CTGAGATACTGGCTGGAACCTGG + Intronic
1145970986 17:28956417-28956439 CTGCAATGTGGGCAGCATCCAGG + Exonic
1152923806 17:83078875-83078897 GTGGGATGTTGGCAGCACCCTGG - Intergenic
1159408294 18:68035311-68035333 CTGAGTTAGTGGCAGCAACATGG - Intergenic
1161724015 19:5918153-5918175 CTGGGATATTCCCAGCCACCTGG - Intronic
1166660616 19:44644395-44644417 CCTCGAAATTGGCAGCAACACGG + Intronic
927090031 2:19703439-19703461 CAGCCTTATTGGTAGCAACCAGG - Intergenic
1171055483 20:21902693-21902715 TTGTGATATTTGCAGCAACATGG - Intergenic
1172225579 20:33303089-33303111 CTGCGATATTGGCAGCAACCAGG + Intronic
1174721858 20:52821315-52821337 CTGCAATATAGGAAGAAACCAGG - Intergenic
1175981544 20:62741214-62741236 CTGCGGGACTGGCAGCAGCCTGG - Intronic
1181489572 22:23253206-23253228 CTGCCACATTTTCAGCAACCTGG + Intronic
952595202 3:35009200-35009222 TTGCCATATTGGCAGTAACATGG - Intergenic
956638543 3:71391568-71391590 CAAGGACATTGGCAGCAACCTGG - Intronic
956666265 3:71644917-71644939 CTGCCTTATTTGCAGCAGCCTGG - Intergenic
956984635 3:74684487-74684509 CAGAGAGATTGGCAGAAACCAGG - Intergenic
961773730 3:129268962-129268984 CTGAGAAAGTGGCAGCTACCAGG + Exonic
965262523 3:166503518-166503540 ATGCGATATTGGCATTAAGCAGG + Intergenic
980466279 4:133187400-133187422 CTTCGATTTTGGGGGCAACCTGG + Intronic
983428631 4:167619776-167619798 CAGTGGTGTTGGCAGCAACCTGG + Intergenic
985054049 4:186020537-186020559 CTGCAATATGGACAGCAACCGGG + Intergenic
985547646 5:518122-518144 CTGCCATTGTGGCATCAACCTGG + Intronic
985702772 5:1383536-1383558 TTGGGATATTGGCAGGATCCCGG + Intergenic
1002699825 5:181114933-181114955 CTGCAACATCGGCAGAAACCTGG + Intergenic
1005326928 6:24711091-24711113 CTGCAATATGGTAAGCAACCAGG + Intronic
1011388301 6:86821641-86821663 CTTAAATATTGGCATCAACCAGG - Intergenic
1013609795 6:111783833-111783855 CTGCAACATTCGCATCAACCAGG + Intronic
1017598630 6:156057969-156057991 CTGCGATTTTGGCAGCAATGTGG - Intergenic
1024096973 7:45989704-45989726 TTGTGAGATTGGCAGGAACCTGG + Intergenic
1024924912 7:54602335-54602357 CTGAAATATTAGCTGCAACCAGG - Intergenic
1030628056 7:111865470-111865492 CTGCCTTATAGGCAGAAACCTGG - Intronic
1032630115 7:133641587-133641609 CAGCGATACTGGCAGCCACCAGG - Intronic
1033635082 7:143204751-143204773 CTGATATATTTGCAGCCACCGGG - Intergenic
1040015428 8:42695616-42695638 CTCCGGTATTGGCAGAATCCTGG + Intergenic
1047654900 8:126966500-126966522 CTGCAATCTTGGAAGGAACCTGG + Intergenic
1049146595 8:141005297-141005319 CTGTGATGTGGGCAGGAACCTGG - Intergenic
1059986037 9:119821576-119821598 CTGCGATGTTCCCAGCCACCTGG + Intergenic
1193774103 X:85622146-85622168 CAGCCATCTTGCCAGCAACCTGG - Intergenic