ID: 1172225580

View in Genome Browser
Species Human (GRCh38)
Location 20:33303090-33303112
Sequence TGCGATATTGGCAGCAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172225570_1172225580 20 Left 1172225570 20:33303047-33303069 CCTCCGCCCTTTGTTCACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1172225580 20:33303090-33303112 TGCGATATTGGCAGCAACCAGGG 0: 1
1: 0
2: 0
3: 4
4: 71
1172225568_1172225580 30 Left 1172225568 20:33303037-33303059 CCAGTGAAGCCCTCCGCCCTTTG 0: 1
1: 0
2: 0
3: 25
4: 122
Right 1172225580 20:33303090-33303112 TGCGATATTGGCAGCAACCAGGG 0: 1
1: 0
2: 0
3: 4
4: 71
1172225575_1172225580 13 Left 1172225575 20:33303054-33303076 CCTTTGTTCACCCTGGGCATCGT 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1172225580 20:33303090-33303112 TGCGATATTGGCAGCAACCAGGG 0: 1
1: 0
2: 0
3: 4
4: 71
1172225573_1172225580 17 Left 1172225573 20:33303050-33303072 CCGCCCTTTGTTCACCCTGGGCA 0: 1
1: 0
2: 1
3: 14
4: 187
Right 1172225580 20:33303090-33303112 TGCGATATTGGCAGCAACCAGGG 0: 1
1: 0
2: 0
3: 4
4: 71
1172225576_1172225580 3 Left 1172225576 20:33303064-33303086 CCCTGGGCATCGTGAGTTCAGTT 0: 1
1: 0
2: 2
3: 9
4: 74
Right 1172225580 20:33303090-33303112 TGCGATATTGGCAGCAACCAGGG 0: 1
1: 0
2: 0
3: 4
4: 71
1172225574_1172225580 14 Left 1172225574 20:33303053-33303075 CCCTTTGTTCACCCTGGGCATCG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1172225580 20:33303090-33303112 TGCGATATTGGCAGCAACCAGGG 0: 1
1: 0
2: 0
3: 4
4: 71
1172225577_1172225580 2 Left 1172225577 20:33303065-33303087 CCTGGGCATCGTGAGTTCAGTTG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1172225580 20:33303090-33303112 TGCGATATTGGCAGCAACCAGGG 0: 1
1: 0
2: 0
3: 4
4: 71
1172225569_1172225580 21 Left 1172225569 20:33303046-33303068 CCCTCCGCCCTTTGTTCACCCTG 0: 1
1: 0
2: 2
3: 9
4: 189
Right 1172225580 20:33303090-33303112 TGCGATATTGGCAGCAACCAGGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172225580 Original CRISPR TGCGATATTGGCAGCAACCA GGG Intronic
900547986 1:3239096-3239118 AGGGAAATTGGCAGCACCCACGG + Intronic
903872542 1:26446959-26446981 TGTGATATTGGCACAAACAAAGG - Intronic
904432395 1:30472866-30472888 TGTGATCTTGGCAACAGCCATGG + Intergenic
904644817 1:31957770-31957792 TGGAATGTTGCCAGCAACCAAGG - Intergenic
906525213 1:46489737-46489759 GGCGTGATTGGCAGCCACCAGGG + Intergenic
910585150 1:88871430-88871452 TGAGATATTGCCAGTTACCATGG + Intronic
913544516 1:119853847-119853869 TGCGGTTTTGGCAGCAATAAGGG - Intergenic
916030086 1:160869019-160869041 TGAGATAATGGCAACAACTAAGG + Intergenic
922914408 1:229244188-229244210 TGCCTTATTGGCAGAAATCATGG + Intergenic
1064594975 10:16934787-16934809 TGCGATATTGCCTGAGACCATGG - Intronic
1064886869 10:20121901-20121923 TGGGATATTGGCATCAATCGGGG + Intronic
1069554301 10:69387173-69387195 TTGGATATTGTCAGGAACCAGGG - Intronic
1072674191 10:97453437-97453459 GGTGATATTGTCAGGAACCAGGG + Intronic
1072884649 10:99262560-99262582 TGGGATATTGGCATTAAGCAGGG - Intergenic
1073875114 10:107914210-107914232 AGCCATATTGACAGAAACCAGGG + Intergenic
1076561369 10:131367419-131367441 TTCAATATTGGCAGAATCCAGGG - Intergenic
1086525188 11:87716295-87716317 AGTGATATTGGGAGGAACCAAGG + Intergenic
1090286114 11:125501043-125501065 TACGTTCTTGGCAGCAAACATGG + Intergenic
1093803514 12:23403044-23403066 TTTGATATTGTCAGAAACCAGGG - Intergenic
1100375137 12:94008092-94008114 TGCTATGCTAGCAGCAACCAAGG + Intergenic
1109289684 13:60458491-60458513 TTCGATATCTGGAGCAACCATGG - Intronic
1110969622 13:81745147-81745169 TGTGAAATGGGCAGAAACCATGG + Intergenic
1121568281 14:94926905-94926927 TGGGATATTGGCAGGAACACTGG - Intergenic
1122757093 14:103990174-103990196 TGGGATGCTGGCAACAACCAGGG - Intronic
1126517916 15:49556618-49556640 TGCCATACTGCAAGCAACCATGG + Intronic
1130878233 15:88032578-88032600 TGCCTTATTGGGAGCACCCAGGG + Intronic
1133525049 16:6596943-6596965 TGTGCTAGTGGCAGAAACCAGGG - Intronic
1138361905 16:56437538-56437560 TGAGACAGTGGCAGCAAACAGGG - Intronic
1139956754 16:70696933-70696955 AGCGAGATTGGCAGCAAAGAGGG - Intronic
1140522445 16:75593514-75593536 TGCGACGTTAGCAGCATCCAAGG + Intergenic
1145959816 17:28880845-28880867 AGCGATTTTGGCAGCAATCTAGG + Exonic
1145970987 17:28956418-28956440 TGCAATGTGGGCAGCATCCAGGG + Exonic
1158029275 18:52942889-52942911 TGAGATATTTGAAGCAAACAGGG + Intronic
1158872738 18:61704267-61704289 TGGGATGTGGGCAGCAAACATGG + Intergenic
927090030 2:19703438-19703460 AGCCTTATTGGTAGCAACCAGGG - Intergenic
927093589 2:19730587-19730609 TGCTATATTGGCAGAAAGAAAGG + Intergenic
938289723 2:130142805-130142827 TGCCATCTGGGCAGCAACCATGG - Intronic
938466803 2:131530133-131530155 TGCCATCTGGGCAGCAACCATGG + Intronic
943462313 2:188184367-188184389 TGCCATCTTGGGAGCAGCCACGG - Intergenic
943791151 2:191933823-191933845 TAAGATATTGGCTGGAACCATGG + Intergenic
1172225580 20:33303090-33303112 TGCGATATTGGCAGCAACCAGGG + Intronic
1181425275 22:22833210-22833232 TCCCATATTTGCAGCATCCAGGG + Intronic
1182621753 22:31622288-31622310 TGGGATATGGGCAGTGACCACGG - Intronic
952305850 3:32145435-32145457 TGCGTTATTTGCAGCCACAAAGG + Intronic
956984634 3:74684486-74684508 AGAGAGATTGGCAGAAACCAGGG - Intergenic
960212508 3:114987637-114987659 TGTGATATTATCAGGAACCAAGG - Intronic
963605912 3:147411465-147411487 AGAGATGTTGGCAGCAAGCAAGG - Intronic
965262524 3:166503519-166503541 TGCGATATTGGCATTAAGCAGGG + Intergenic
966279431 3:178210510-178210532 TGGGATATTGGCATTAAGCAGGG - Intergenic
969097940 4:4748139-4748161 TGCAATGTTGGCAGAAACCATGG + Intergenic
983577271 4:169271902-169271924 TGCGATGATGGCAGCCACCCAGG - Intergenic
985495342 5:201128-201150 TGCGATGTTGGGAGGAGCCAGGG - Exonic
985702773 5:1383537-1383559 TGGGATATTGGCAGGATCCCGGG + Intergenic
995550641 5:113277759-113277781 TGCGATATTGGCATCTACTGTGG + Intronic
1003166183 6:3680392-3680414 TGATATATTAGCAGCAAGCAAGG - Intergenic
1005326929 6:24711092-24711114 TGCAATATGGTAAGCAACCAGGG + Intronic
1010618003 6:78037247-78037269 TGTGATACTAGCAGCAACCTTGG - Intergenic
1011388300 6:86821640-86821662 TTAAATATTGGCATCAACCAGGG - Intergenic
1012081855 6:94769175-94769197 TCCTATGTTGGCAACAACCAGGG - Intergenic
1019311754 7:365460-365482 TGCCACATTTGCAACAACCATGG - Intergenic
1019669533 7:2270018-2270040 TGCGTTTTTGGAAGCTACCAGGG - Intronic
1024096974 7:45989705-45989727 TGTGAGATTGGCAGGAACCTGGG + Intergenic
1024924911 7:54602334-54602356 TGAAATATTAGCTGCAACCAGGG - Intergenic
1026271084 7:68837477-68837499 TGCTATAGGGGCAGGAACCATGG + Intergenic
1027913202 7:84279812-84279834 TGTGATATTGGCTGGATCCATGG + Intronic
1030561082 7:111086931-111086953 TGCAATATAGTCAGCAACAAGGG - Intronic
1040537065 8:48319598-48319620 TGCGTGATTGGCATCAGCCAGGG + Intergenic
1046303033 8:112323327-112323349 TGAGATATTGGCAGCAAGATTGG - Intronic
1048152513 8:131907935-131907957 TGAGATCTGGGCAGCAAACAGGG - Intronic
1048414764 8:134213972-134213994 TATGATATTTGCAGCCACCAAGG + Intergenic
1052164330 9:25305450-25305472 TGAAATATTGAAAGCAACCAAGG + Intergenic
1056294615 9:85180076-85180098 TGCTTTATTGCCAGCATCCAGGG + Intergenic
1060210669 9:121708310-121708332 TGGGATCTTGACATCAACCAGGG - Intronic
1060955703 9:127637644-127637666 TCGGATATTGGCAGTAACCCAGG + Intronic
1198126740 X:133652018-133652040 TGAGCTCTTGGAAGCAACCATGG - Intronic
1201938643 Y:19434902-19434924 AGCCATCTTGGAAGCAACCATGG - Intergenic