ID: 1172225581

View in Genome Browser
Species Human (GRCh38)
Location 20:33303091-33303113
Sequence GCGATATTGGCAGCAACCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172225570_1172225581 21 Left 1172225570 20:33303047-33303069 CCTCCGCCCTTTGTTCACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1172225581 20:33303091-33303113 GCGATATTGGCAGCAACCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 59
1172225575_1172225581 14 Left 1172225575 20:33303054-33303076 CCTTTGTTCACCCTGGGCATCGT 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1172225581 20:33303091-33303113 GCGATATTGGCAGCAACCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 59
1172225569_1172225581 22 Left 1172225569 20:33303046-33303068 CCCTCCGCCCTTTGTTCACCCTG 0: 1
1: 0
2: 2
3: 9
4: 189
Right 1172225581 20:33303091-33303113 GCGATATTGGCAGCAACCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 59
1172225573_1172225581 18 Left 1172225573 20:33303050-33303072 CCGCCCTTTGTTCACCCTGGGCA 0: 1
1: 0
2: 1
3: 14
4: 187
Right 1172225581 20:33303091-33303113 GCGATATTGGCAGCAACCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 59
1172225576_1172225581 4 Left 1172225576 20:33303064-33303086 CCCTGGGCATCGTGAGTTCAGTT 0: 1
1: 0
2: 2
3: 9
4: 74
Right 1172225581 20:33303091-33303113 GCGATATTGGCAGCAACCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 59
1172225577_1172225581 3 Left 1172225577 20:33303065-33303087 CCTGGGCATCGTGAGTTCAGTTG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1172225581 20:33303091-33303113 GCGATATTGGCAGCAACCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 59
1172225574_1172225581 15 Left 1172225574 20:33303053-33303075 CCCTTTGTTCACCCTGGGCATCG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1172225581 20:33303091-33303113 GCGATATTGGCAGCAACCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172225581 Original CRISPR GCGATATTGGCAGCAACCAG GGG Intronic
907006257 1:50917438-50917460 GAGATTTTTGCAGCAATCAGAGG + Intronic
907078490 1:51599700-51599722 GTGATATTTGCAGCATCCACAGG + Intronic
907819982 1:57957746-57957768 GCAACATGGGCAGAAACCAGAGG + Intronic
913544515 1:119853846-119853868 GCGGTTTTGGCAGCAATAAGGGG - Intergenic
923160443 1:231310211-231310233 GCGATATTCGCAGCTAATAGCGG - Intergenic
1065358030 10:24861595-24861617 GCAAAATTGGGAGCAAACAGAGG - Intronic
1069554300 10:69387172-69387194 TGGATATTGTCAGGAACCAGGGG - Intronic
1077864728 11:6212545-6212567 TTGAAATTGGCCGCAACCAGTGG - Intronic
1083705888 11:64514980-64515002 GAGATACTGTCACCAACCAGGGG + Intergenic
1084425287 11:69080971-69080993 GCGATGGGGGCAGGAACCAGGGG + Intronic
1108862960 13:54884795-54884817 AAGAAATTGGCAGCTACCAGCGG + Intergenic
1111431076 13:88148500-88148522 GCTATATTGGGAGAAAACAGTGG + Intergenic
1122757092 14:103990173-103990195 GGGATGCTGGCAACAACCAGGGG - Intronic
1127711541 15:61604019-61604041 GCAATATTGGGAGCAACAATAGG - Intergenic
1128240528 15:66098206-66098228 GCGATCTTGGCACCAAGCAAAGG + Intronic
1133525048 16:6596942-6596964 GTGCTAGTGGCAGAAACCAGGGG - Intronic
1135793817 16:25422798-25422820 GGGATATTGTAAGCTACCAGTGG - Intergenic
1138468875 16:57215450-57215472 GCTACATTGGGAGCCACCAGAGG - Intronic
1139956753 16:70696932-70696954 GCGAGATTGGCAGCAAAGAGGGG - Intronic
1154948120 18:21182458-21182480 GTGATATTGGCAGGACGCAGTGG - Intergenic
1156164628 18:34403389-34403411 GCAATGCTGGCAGCAACCACAGG - Intergenic
1158423871 18:57321972-57321994 GAGATGTTGTCAGCAATCAGGGG + Intergenic
1158861385 18:61595389-61595411 GCTATGTAGGCAGGAACCAGTGG - Intergenic
1159180091 18:64892070-64892092 GCAATGCTGGCAGCCACCAGAGG + Intergenic
1160563993 18:79775707-79775729 GGGGTATTGGCAGCGCCCAGGGG + Intergenic
1163386800 19:17004886-17004908 GCGATATTGGCAGTATCTGGGGG - Intronic
1164359935 19:27494642-27494664 GTGATATTGGGAGCAATTAGAGG + Intergenic
1165135360 19:33664768-33664790 ACAAGATTGGCAGTAACCAGAGG - Intronic
927090029 2:19703437-19703459 GCCTTATTGGTAGCAACCAGGGG - Intergenic
935230763 2:101094027-101094049 GGGATATTGGTAGCAACAGGAGG - Intronic
936009708 2:108917739-108917761 GTGACAGTGGCAGCAAGCAGAGG - Intronic
938289722 2:130142804-130142826 GCCATCTGGGCAGCAACCATGGG - Intronic
938466804 2:131530134-131530156 GCCATCTGGGCAGCAACCATGGG + Intronic
941319530 2:164037870-164037892 GCCATAGTGGAAGCAAACAGAGG + Intergenic
1172225581 20:33303091-33303113 GCGATATTGGCAGCAACCAGGGG + Intronic
1175143729 20:56880396-56880418 GTCATTGTGGCAGCAACCAGAGG - Intergenic
1175980224 20:62735070-62735092 GCATGATGGGCAGCAACCAGTGG + Intronic
1180873591 22:19162705-19162727 GCGCTATTCACAGCAGCCAGAGG - Intergenic
1184871361 22:47240372-47240394 GGGAAATTGGCAGCAAACGGCGG + Intergenic
1184943527 22:47785138-47785160 GCTATGAAGGCAGCAACCAGAGG - Intergenic
957417553 3:79926144-79926166 GCAATATTTGCAGCAAGTAGTGG + Intergenic
963605911 3:147411464-147411486 GAGATGTTGGCAGCAAGCAAGGG - Intronic
966101254 3:176271071-176271093 TAGATATTGCCAGCAATCAGTGG - Intergenic
969097941 4:4748140-4748162 GCAATGTTGGCAGAAACCATGGG + Intergenic
974348282 4:60710865-60710887 GCTATATTCGAAGCTACCAGAGG - Intergenic
981248976 4:142575856-142575878 GTGATATTTACAGTAACCAGAGG - Intronic
981558568 4:146022857-146022879 GAGATATTGGCAGTAGCCTGGGG - Intergenic
982870189 4:160569810-160569832 GCCATTTGAGCAGCAACCAGAGG - Intergenic
983428633 4:167619778-167619800 GTGGTGTTGGCAGCAACCTGGGG + Intergenic
987131382 5:14863316-14863338 GAGGGATTGGCACCAACCAGTGG - Intronic
994163047 5:96578978-96579000 GCAATACTGGCAGGAACCAGTGG - Intronic
1005989611 6:30894792-30894814 GTGATATAGACAGTAACCAGGGG - Intronic
1012913825 6:105146806-105146828 ACTATATTGTCAGAAACCAGAGG + Intergenic
1013049580 6:106519483-106519505 GAGATTCTGCCAGCAACCAGAGG + Exonic
1013240466 6:108240697-108240719 GCAACATTGGCAGCAAACAGTGG + Intronic
1017448399 6:154530095-154530117 GCGATATTGGAAGCAGCAATTGG + Intergenic
1022515520 7:30972572-30972594 GCTGTATTGGCAGCAACAATAGG + Intronic
1024924910 7:54602333-54602355 GAAATATTAGCTGCAACCAGGGG - Intergenic
1027187906 7:75982700-75982722 GGAATCTGGGCAGCAACCAGGGG - Intronic
1028905570 7:96150874-96150896 GCTATATAGCCAGCAAGCAGAGG + Intronic
1034776481 7:153831961-153831983 GCGCTCATGACAGCAACCAGAGG - Intergenic
1035490787 7:159275942-159275964 GGGATAATGGAAGCAACAAGGGG - Intergenic
1039399308 8:37255250-37255272 GGGAAATTGGCATCAACCTGAGG - Intergenic
1200021688 X:153216658-153216680 GCGCCATTGGCAGAGACCAGAGG + Intergenic