ID: 1172225582

View in Genome Browser
Species Human (GRCh38)
Location 20:33303092-33303114
Sequence CGATATTGGCAGCAACCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172225570_1172225582 22 Left 1172225570 20:33303047-33303069 CCTCCGCCCTTTGTTCACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1172225582 20:33303092-33303114 CGATATTGGCAGCAACCAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1172225575_1172225582 15 Left 1172225575 20:33303054-33303076 CCTTTGTTCACCCTGGGCATCGT 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1172225582 20:33303092-33303114 CGATATTGGCAGCAACCAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1172225577_1172225582 4 Left 1172225577 20:33303065-33303087 CCTGGGCATCGTGAGTTCAGTTG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1172225582 20:33303092-33303114 CGATATTGGCAGCAACCAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1172225574_1172225582 16 Left 1172225574 20:33303053-33303075 CCCTTTGTTCACCCTGGGCATCG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1172225582 20:33303092-33303114 CGATATTGGCAGCAACCAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1172225576_1172225582 5 Left 1172225576 20:33303064-33303086 CCCTGGGCATCGTGAGTTCAGTT 0: 1
1: 0
2: 2
3: 9
4: 74
Right 1172225582 20:33303092-33303114 CGATATTGGCAGCAACCAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1172225569_1172225582 23 Left 1172225569 20:33303046-33303068 CCCTCCGCCCTTTGTTCACCCTG 0: 1
1: 0
2: 2
3: 9
4: 189
Right 1172225582 20:33303092-33303114 CGATATTGGCAGCAACCAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1172225573_1172225582 19 Left 1172225573 20:33303050-33303072 CCGCCCTTTGTTCACCCTGGGCA 0: 1
1: 0
2: 1
3: 14
4: 187
Right 1172225582 20:33303092-33303114 CGATATTGGCAGCAACCAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172225582 Original CRISPR CGATATTGGCAGCAACCAGG GGG Intronic
902166585 1:14576890-14576912 GGATATAGGCAGGAACCAGGTGG - Intergenic
911906673 1:103577774-103577796 TGATAATGGGAGCAACCAAGTGG + Exonic
911910178 1:103624150-103624172 TGATAATGGGAGCAACCAAGTGG + Exonic
911913274 1:103662940-103662962 TGATAATGGGAGCAACCAAGTGG + Exonic
911915180 1:103689007-103689029 TGATAATGGGAGCAACCAAGTGG - Exonic
911917596 1:103718275-103718297 TGATAATGGGAGCAACCAAGTGG + Intronic
911920687 1:103757078-103757100 TGATAATGGGAGCAACCAAGTGG + Exonic
912260137 1:108102969-108102991 GAATGATGGCAGCAACCAGGTGG + Intergenic
916847354 1:168666084-168666106 CAATATTGGCAGCATGCAAGAGG - Intergenic
921789162 1:219270090-219270112 AGTTATTGGCAGAATCCAGGTGG + Intergenic
1073708111 10:106010197-106010219 GGACATAGGCAGCAACCAGGTGG - Intergenic
1077864727 11:6212544-6212566 TGAAATTGGCCGCAACCAGTGGG - Intronic
1080927943 11:36777543-36777565 TATTCTTGGCAGCAACCAGGTGG + Intergenic
1095112905 12:38317319-38317341 CGATATTGTCAGCTGCCAAGAGG - Intronic
1096010263 12:48207851-48207873 GGAGAATGGCAGGAACCAGGAGG - Intergenic
1102703938 12:114864860-114864882 AGATATTGGCAGCCACCTGAAGG - Intergenic
1103436567 12:120931440-120931462 GGAAATTGGCAGAAACCAAGGGG + Intergenic
1103731761 12:123032602-123032624 CGATCTTGACAGCCACCGGGAGG + Intronic
1106469342 13:30040522-30040544 CGAGATCTGCAGCAAGCAGGAGG - Intergenic
1107332256 13:39313766-39313788 CGGTTTTTGCAGCTACCAGGAGG - Intergenic
1108862961 13:54884796-54884818 AGAAATTGGCAGCTACCAGCGGG + Intergenic
1119582217 14:75795727-75795749 TGGTATTCGCAGCAACCTGGAGG - Intronic
1120511729 14:85423877-85423899 AGAGATTGGCAGGAACCAGAAGG + Intergenic
1120691951 14:87602543-87602565 CCATATTGGCAGCAGACAGCAGG + Intergenic
1122884767 14:104706131-104706153 CGACATGAGCAGCCACCAGGAGG + Exonic
1129717770 15:77862134-77862156 GGACAGTGGCAGCACCCAGGAGG + Intergenic
1143416103 17:6751883-6751905 TGAGATTTGCAGCAACCAAGGGG + Intergenic
1152617607 17:81345170-81345192 CGATATTGGCCCCAATCTGGCGG - Intergenic
1160563994 18:79775708-79775730 GGGTATTGGCAGCGCCCAGGGGG + Intergenic
927765080 2:25799412-25799434 TGATGGTGGCAGCAACAAGGAGG - Intronic
935869920 2:107436557-107436579 TGAAAATGGCAGAAACCAGGAGG - Intergenic
936340760 2:111630765-111630787 CCATAGTGGCAGCAGCCAGGAGG - Intergenic
937331611 2:121034054-121034076 AGAAAGTGGCAGCATCCAGGAGG + Intergenic
938289720 2:130142803-130142825 CCATCTGGGCAGCAACCATGGGG - Intronic
938466806 2:131530135-131530157 CCATCTGGGCAGCAACCATGGGG + Intronic
940851047 2:158688567-158688589 GGAGATTGGAAGCTACCAGGAGG - Intergenic
944371445 2:198988080-198988102 CCAGCTTGGCAGAAACCAGGAGG - Intergenic
1172225582 20:33303092-33303114 CGATATTGGCAGCAACCAGGGGG + Intronic
1172964962 20:38827982-38828004 CAATATTGGCAGCAGCCTGGAGG - Intronic
1180951264 22:19721657-19721679 CGTTATAGGCAGCAACACGGTGG + Exonic
1183004136 22:34886285-34886307 CGATATAGAAAGCAACCAAGGGG - Intergenic
951111887 3:18813338-18813360 TCATATTGGCTGCATCCAGGTGG - Intergenic
963317255 3:143772789-143772811 TGAAATTGGCATCATCCAGGTGG - Intronic
967840358 3:194000342-194000364 GGACACTGCCAGCAACCAGGTGG - Intergenic
974137130 4:57833143-57833165 GGATATTAGCAGAAAACAGGAGG + Intergenic
975369404 4:73567739-73567761 GAATATAGGCAGCAACCAGGTGG - Intergenic
979646650 4:123077470-123077492 GGATACTGGCAGAAACCATGAGG + Intronic
981558567 4:146022856-146022878 AGATATTGGCAGTAGCCTGGGGG - Intergenic
981796871 4:148605560-148605582 AAATTTTGGCAGCAACCATGTGG + Intergenic
983428634 4:167619779-167619801 TGGTGTTGGCAGCAACCTGGGGG + Intergenic
986038839 5:3967244-3967266 GGATATCTGCAGCAACCTGGAGG - Intergenic
996331041 5:122329385-122329407 CGATATTGGGAGACACCGGGAGG - Intronic
997710186 5:135997575-135997597 CTATATTGACAGGAAGCAGGTGG - Intergenic
1000874960 5:166625768-166625790 TTATAGTGTCAGCAACCAGGAGG - Intergenic
1003069201 6:2931390-2931412 CGCTAATGGCAGCTTCCAGGTGG - Intergenic
1009864711 6:69382713-69382735 CAAGTTTGGCAGGAACCAGGAGG - Intronic
1013240467 6:108240698-108240720 CAACATTGGCAGCAAACAGTGGG + Intronic
1024810633 7:53207402-53207424 GGGCAGTGGCAGCAACCAGGGGG + Intergenic
1026220896 7:68396820-68396842 AGCTATTCGCAGCAACCAAGTGG - Intergenic
1035139256 7:156740282-156740304 AGTTATTGGCAGCAAAGAGGAGG + Intronic
1036669296 8:10770183-10770205 CCATATTGGCAGTGTCCAGGTGG - Intronic
1037036332 8:14172720-14172742 CGGTGTTGGCAGCTAGCAGGAGG + Intronic
1044599226 8:93987058-93987080 GGAGATGGGCAGCAACCAGAAGG + Intergenic
1044928518 8:97230003-97230025 AGAAATGGGCAGAAACCAGGGGG + Intergenic
1048342112 8:133548238-133548260 CTCTCTTGGCAGCAGCCAGGGGG + Intronic
1048578633 8:135712575-135712597 GGATATTGGCAACAATCTGGTGG - Intergenic
1055708044 9:79029790-79029812 CTATATTGGTTGAAACCAGGTGG + Intergenic
1057325060 9:94054834-94054856 GGAGATTTGCAGCAACCAGTTGG + Intronic
1060035919 9:120255622-120255644 AGATAATGACAGCAACAAGGAGG - Intergenic