ID: 1172227886

View in Genome Browser
Species Human (GRCh38)
Location 20:33317301-33317323
Sequence CCAGGTTGAGCAGGAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172227886_1172227894 25 Left 1172227886 20:33317301-33317323 CCTTTCTCTCCTGCTCAACCTGG No data
Right 1172227894 20:33317349-33317371 AAAGTTCTAACCACCTCCTCTGG No data
1172227886_1172227895 26 Left 1172227886 20:33317301-33317323 CCTTTCTCTCCTGCTCAACCTGG No data
Right 1172227895 20:33317350-33317372 AAGTTCTAACCACCTCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172227886 Original CRISPR CCAGGTTGAGCAGGAGAGAA AGG (reversed) Intergenic
No off target data available for this crispr